Incidental Mutation 'R4117:Gm11492'
ID315142
Institutional Source Beutler Lab
Gene Symbol Gm11492
Ensembl Gene ENSMUSG00000090107
Gene Namepredicted gene 11492
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87566653-87569250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87568282 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 494 (F494S)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
Predicted Effect probably damaging
Transcript: ENSMUST00000060360
AA Change: F494S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: F494S

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Meta Mutation Damage Score 0.2592 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Gm11492
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gm11492 APN 11 87568249 missense probably benign 0.07
IGL01993:Gm11492 APN 11 87567729 missense possibly damaging 0.85
IGL02566:Gm11492 APN 11 87567642 missense probably benign 0.00
IGL03213:Gm11492 APN 11 87567358 unclassified probably null
IGL03388:Gm11492 APN 11 87568216 nonsense probably null
R0050:Gm11492 UTSW 11 87567346 missense probably damaging 1.00
R1479:Gm11492 UTSW 11 87567418 missense probably damaging 1.00
R1851:Gm11492 UTSW 11 87568915 missense probably damaging 1.00
R1862:Gm11492 UTSW 11 87567235 missense possibly damaging 0.48
R1913:Gm11492 UTSW 11 87567012 missense probably benign
R3149:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3176:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3276:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R4021:Gm11492 UTSW 11 87567280 missense probably damaging 1.00
R4332:Gm11492 UTSW 11 87567904 missense possibly damaging 0.95
R4515:Gm11492 UTSW 11 87568057 missense probably benign
R4663:Gm11492 UTSW 11 87567603 missense probably damaging 0.98
R4952:Gm11492 UTSW 11 87567772 missense probably benign 0.00
R5015:Gm11492 UTSW 11 87567217 missense possibly damaging 0.95
R5176:Gm11492 UTSW 11 87567532 missense probably benign 0.02
R5711:Gm11492 UTSW 11 87567897 missense probably benign 0.07
R6305:Gm11492 UTSW 11 87567319 missense probably benign 0.00
T0970:Gm11492 UTSW 11 87567732 missense probably damaging 0.98
Z1177:Gm11492 UTSW 11 87567922 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGAACCTAAGTCGCCTCC -3'
(R):5'- CTCTGATGTCAGCAGCTTGG -3'

Sequencing Primer
(F):5'- CCCTTTAGAGTCCTTTTATGAAATGG -3'
(R):5'- CTTGGGGCTCACTGAAGCTG -3'
Posted On2015-05-14