Incidental Mutation 'R4117:Rdh12'
ID315143
Institutional Source Beutler Lab
Gene Symbol Rdh12
Ensembl Gene ENSMUSG00000021123
Gene Nameretinol dehydrogenase 12
SynonymsA930033N07Rik
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79208914-79222665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79213645 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 172 (R172C)
Ref Sequence ENSEMBL: ENSMUSP00000112543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021548] [ENSMUST00000122227] [ENSMUST00000140823]
Predicted Effect probably damaging
Transcript: ENSMUST00000021548
AA Change: R184C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021548
Gene: ENSMUSG00000021123
AA Change: R184C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:KR 40 209 7.4e-13 PFAM
Pfam:adh_short 40 243 1.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122227
AA Change: R172C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112543
Gene: ENSMUSG00000021123
AA Change: R172C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:KR 40 202 7.4e-9 PFAM
Pfam:adh_short 40 207 8.3e-16 PFAM
Pfam:Epimerase 42 227 2.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140823
SMART Domains Protein: ENSMUSP00000118851
Gene: ENSMUSG00000021123

DomainStartEndE-ValueType
Pfam:KR 28 130 3e-11 PFAM
Pfam:adh_short 28 137 2.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151980
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: The protein encoded by this gene is an NADPH-dependent retinal reductase whose highest activity is toward 9-cis and all-trans-retinol. The encoded enzyme also plays a role in the metabolism of short-chain aldehydes but does not exhibit steroid dehydrogenase activity. Defects in the human gene are associated with Leber congenital amaurosis type 13, and Retinitis Pigmentosa 53. [provided by RefSeq, Sep 2015]
PHENOTYPE: Deletion of this gene in mice results in slowed kinetics of all-trans-retinal reduction leading to delayed dark adaptation and increased susceptibility to light-induced photoreceptor apoptosis from accelerated 11-cis-retinal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Rdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Rdh12 APN 12 79211402 missense probably benign 0.25
IGL02651:Rdh12 APN 12 79222052 missense probably damaging 1.00
IGL02828:Rdh12 APN 12 79218685 missense probably damaging 1.00
R1070:Rdh12 UTSW 12 79213748 missense probably damaging 1.00
R1394:Rdh12 UTSW 12 79209065 missense probably benign
R1395:Rdh12 UTSW 12 79209065 missense probably benign
R1467:Rdh12 UTSW 12 79213748 missense probably damaging 1.00
R1467:Rdh12 UTSW 12 79213748 missense probably damaging 1.00
R1591:Rdh12 UTSW 12 79211504 missense probably damaging 1.00
R1633:Rdh12 UTSW 12 79218724 missense probably damaging 0.97
R3753:Rdh12 UTSW 12 79213672 nonsense probably null
R5001:Rdh12 UTSW 12 79212742 missense probably damaging 1.00
R5509:Rdh12 UTSW 12 79210784 intron probably null
Predicted Primers PCR Primer
(F):5'- AAGTCCTGCCATTCGATCCAC -3'
(R):5'- TCTGGACCAAGGATTTCGTTCTTG -3'

Sequencing Primer
(F):5'- CACACCCCTGAGCCTAGAGATG -3'
(R):5'- TCTCCATACTTACCTTGGAG -3'
Posted On2015-05-14