Incidental Mutation 'R4117:Serpinb9'
ID315144
Institutional Source Beutler Lab
Gene Symbol Serpinb9
Ensembl Gene ENSMUSG00000045827
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9
Synonymsovalbumin, PI-9, Spi6
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33003250-33017957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33015596 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 291 (D291E)
Ref Sequence ENSEMBL: ENSMUSP00000099002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006391] [ENSMUST00000063191]
Predicted Effect probably benign
Transcript: ENSMUST00000006391
AA Change: D291E

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006391
Gene: ENSMUSG00000045827
AA Change: D291E

DomainStartEndE-ValueType
SERPIN 13 374 6.04e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063191
AA Change: D291E

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099002
Gene: ENSMUSG00000045827
AA Change: D291E

DomainStartEndE-ValueType
SERPIN 13 374 6.04e-174 SMART
Meta Mutation Damage Score 0.4447 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease inhibitor family which are also known as serpins. The encoded protein belongs to a subfamily of intracellular serpins. This protein inhibits the activity of the effector molecule granzyme B. Overexpression of this protein may prevent cytotoxic T-lymphocytes from eliminating certain tumor cells. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice show defective CTL immunity and clearance of LCMV. Following infection with LCMV or L. monocytogenes, mutant CTLs display a breakdown of cytotoxic granule integrity, increased cytoplasmic granzyme B, and reduced survival due to increased granzyme B-mediated apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Serpinb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Serpinb9 APN 13 33006690 missense probably damaging 1.00
IGL03385:Serpinb9 APN 13 33007996 splice site probably benign
R0173:Serpinb9 UTSW 13 33010722 missense probably benign 0.03
R1586:Serpinb9 UTSW 13 33015486 missense probably benign 0.00
R3708:Serpinb9 UTSW 13 33008019 missense possibly damaging 0.89
R3853:Serpinb9 UTSW 13 33015520 missense possibly damaging 0.70
R3903:Serpinb9 UTSW 13 33010810 missense possibly damaging 0.78
R4903:Serpinb9 UTSW 13 33008864 missense probably damaging 1.00
R4964:Serpinb9 UTSW 13 33008864 missense probably damaging 1.00
R4966:Serpinb9 UTSW 13 33008864 missense probably damaging 1.00
R5140:Serpinb9 UTSW 13 33006561 missense probably benign 0.03
R5463:Serpinb9 UTSW 13 33015676 missense probably damaging 0.98
R6165:Serpinb9 UTSW 13 33008824 missense possibly damaging 0.81
R7510:Serpinb9 UTSW 13 33010785 missense probably damaging 0.99
R7511:Serpinb9 UTSW 13 33008071 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACTGTGAATAGGAGTGCTCTG -3'
(R):5'- GGTCAGCACAGAATGTTGGG -3'

Sequencing Primer
(F):5'- CTCTGTGGTTCTGAGGAAGACC -3'
(R):5'- TGTTGGGACAGAAGAGGCAC -3'
Posted On2015-05-14