Incidental Mutation 'R4117:Adamts16'
ID315145
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70727802-70841811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70767992 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 775 (Y775H)
Ref Sequence ENSEMBL: ENSMUSP00000105316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
Predicted Effect probably benign
Transcript: ENSMUST00000080145
AA Change: Y775H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: Y775H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109694
AA Change: Y775H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: Y775H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Meta Mutation Damage Score 0.1042 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70795484 missense probably benign 0.01
IGL01338:Adamts16 APN 13 70836115 missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70793141 missense probably benign 0.01
IGL01804:Adamts16 APN 13 70800961 nonsense probably null
IGL01874:Adamts16 APN 13 70768704 missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70787147 missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70772929 missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02357:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02429:Adamts16 APN 13 70787170 splice site probably benign
IGL02450:Adamts16 APN 13 70836300 missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70738778 critical splice donor site probably null
IGL03356:Adamts16 APN 13 70753291 missense probably benign 0.00
swap UTSW 13 70779518 critical splice donor site probably benign
switcheroo UTSW 13 70800954 missense probably benign
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0201:Adamts16 UTSW 13 70779644 missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70779611 missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70791794 critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70779552 missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70738955 missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70768647 missense probably benign
R0524:Adamts16 UTSW 13 70800894 missense probably benign 0.00
R0590:Adamts16 UTSW 13 70800954 missense probably benign
R0734:Adamts16 UTSW 13 70738481 splice site probably benign
R0787:Adamts16 UTSW 13 70738829 missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70768692 missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70763561 splice site probably benign
R1027:Adamts16 UTSW 13 70767802 missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1535:Adamts16 UTSW 13 70791794 critical splice donor site probably null
R1617:Adamts16 UTSW 13 70798035 missense probably benign 0.09
R1700:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70779598 synonymous probably null
R1869:Adamts16 UTSW 13 70735747 missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70791886 missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70753267 missense probably benign 0.39
R2018:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70801007 missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3411:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3842:Adamts16 UTSW 13 70738891 missense possibly damaging 0.92
R4435:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70779624 missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70753196 nonsense probably null
R5464:Adamts16 UTSW 13 70761749 missense probably benign 0.01
R5613:Adamts16 UTSW 13 70730134 missense probably benign 0.01
R5667:Adamts16 UTSW 13 70836375 nonsense probably null
R5735:Adamts16 UTSW 13 70836218 missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70738498 missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70728910 missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70770274 nonsense probably null
R6351:Adamts16 UTSW 13 70836203 missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70779570 missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70728898 missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70768520 intron probably null
R6996:Adamts16 UTSW 13 70798038 critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70772955 nonsense probably null
R7356:Adamts16 UTSW 13 70836280 missense probably benign 0.03
R7509:Adamts16 UTSW 13 70787164 missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70730115 missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70836146 missense probably damaging 0.97
R8231:Adamts16 UTSW 13 70777480 missense probably damaging 0.99
R8232:Adamts16 UTSW 13 70793098 missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70761773 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTGGTCTCTACCTCCAC -3'
(R):5'- ATTACGCCTCCAACCAATGATG -3'

Sequencing Primer
(F):5'- CCACAATCAGAGTTTCATTGGTTGG -3'
(R):5'- GCCTCCAACCAATGATGAAAAGGG -3'
Posted On2015-05-14