Incidental Mutation 'R4117:Stmn4'
ID315146
Institutional Source Beutler Lab
Gene Symbol Stmn4
Ensembl Gene ENSMUSG00000022044
Gene Namestathmin-like 4
SynonymsRB3
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66344296-66361680 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 66361132 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 217 (*217Q)
Ref Sequence ENSEMBL: ENSMUSP00000113759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074523] [ENSMUST00000118426] [ENSMUST00000120229] [ENSMUST00000121955] [ENSMUST00000134440] [ENSMUST00000152093]
Predicted Effect probably null
Transcript: ENSMUST00000074523
AA Change: *190Q
SMART Domains Protein: ENSMUSP00000074113
Gene: ENSMUSG00000022044
AA Change: *190Q

DomainStartEndE-ValueType
Pfam:Stathmin 48 187 1.6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118426
SMART Domains Protein: ENSMUSP00000113629
Gene: ENSMUSG00000022044

DomainStartEndE-ValueType
Pfam:Stathmin 48 176 3.9e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120229
AA Change: *217Q
SMART Domains Protein: ENSMUSP00000113759
Gene: ENSMUSG00000022044
AA Change: *217Q

DomainStartEndE-ValueType
Pfam:Stathmin 78 211 3.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121955
SMART Domains Protein: ENSMUSP00000113788
Gene: ENSMUSG00000022044

DomainStartEndE-ValueType
Pfam:Stathmin 75 203 1.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147477
Predicted Effect probably benign
Transcript: ENSMUST00000152093
Meta Mutation Damage Score 0.8556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Stmn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0271:Stmn4 UTSW 14 66356283 nonsense probably null
R0541:Stmn4 UTSW 14 66357939 missense probably benign 0.15
R1118:Stmn4 UTSW 14 66354395 utr 5 prime probably benign
R1902:Stmn4 UTSW 14 66355609 missense probably damaging 1.00
R4276:Stmn4 UTSW 14 66355717 intron probably benign
R5430:Stmn4 UTSW 14 66358014 missense possibly damaging 0.92
R5804:Stmn4 UTSW 14 66356299 missense probably benign
R7552:Stmn4 UTSW 14 66356278 missense probably damaging 1.00
R7879:Stmn4 UTSW 14 66357939 missense probably benign 0.01
R8007:Stmn4 UTSW 14 66355583 splice site probably benign
R8233:Stmn4 UTSW 14 66357892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAGTTCGTGCACTCTG -3'
(R):5'- ATAGGATGGCTTCACTGGTCAATC -3'

Sequencing Primer
(F):5'- TAGGATACCTTCGCTGACAGC -3'
(R):5'- GATGGCTTCACTGGTCAATCTTTTAC -3'
Posted On2015-05-14