Incidental Mutation 'R4117:Gm11127'
ID315147
Institutional Source Beutler Lab
Gene Symbol Gm11127
Ensembl Gene ENSMUSG00000079492
Gene Namepredicted gene 11127
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4117 (G1)
Quality Score124
Status Not validated
Chromosome17
Chromosomal Location36055816-36058371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36057604 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 144 (D144G)
Ref Sequence ENSEMBL: ENSMUSP00000109371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097331] [ENSMUST00000113742]
Predicted Effect probably benign
Transcript: ENSMUST00000097331
SMART Domains Protein: ENSMUSP00000094943
Gene: ENSMUSG00000073407

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113742
AA Change: D144G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109371
Gene: ENSMUSG00000079492
AA Change: D144G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 6.4e-81 PFAM
IGc1 220 291 2.53e-23 SMART
transmembrane domain 306 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Gm11127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01859:Gm11127 APN 17 36058011 missense possibly damaging 0.78
IGL02007:Gm11127 APN 17 36056330 missense possibly damaging 0.50
R1075:Gm11127 UTSW 17 36056146 missense probably benign 0.05
R1829:Gm11127 UTSW 17 36058004 missense probably damaging 1.00
R1944:Gm11127 UTSW 17 36058005 missense probably damaging 1.00
R4584:Gm11127 UTSW 17 36057667 missense probably damaging 1.00
R4626:Gm11127 UTSW 17 36057896 frame shift probably null
R4649:Gm11127 UTSW 17 36057876 missense possibly damaging 0.90
R4864:Gm11127 UTSW 17 36058361 utr 3 prime probably benign
R5412:Gm11127 UTSW 17 36056044 missense probably benign 0.01
R5430:Gm11127 UTSW 17 36056075 missense probably benign 0.00
R5547:Gm11127 UTSW 17 36057904 missense possibly damaging 0.63
R5896:Gm11127 UTSW 17 36056344 missense probably benign 0.01
R5974:Gm11127 UTSW 17 36056785 missense probably benign 0.05
R6456:Gm11127 UTSW 17 36056610 missense probably damaging 1.00
R7073:Gm11127 UTSW 17 36058343 missense unknown
R7217:Gm11127 UTSW 17 36056343 missense probably benign 0.01
R7652:Gm11127 UTSW 17 36056783 missense probably damaging 1.00
R8267:Gm11127 UTSW 17 36056783 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TACCTGAGTGTTGCTGAGCTTC -3'
(R):5'- AGTGTCAGAGGTCATGTCCC -3'

Sequencing Primer
(F):5'- CCTCCAACAATCTGTGGAGTG -3'
(R):5'- CTCACGAACTCACTGAAGGGATATG -3'
Posted On2015-05-14