Incidental Mutation 'R4117:Npas4'
ID315148
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Nameneuronal PAS domain protein 4
SynonymsNpas4, LE-PAS, Nxf
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4984355-4989971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4987363 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 301 (Y301C)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
Predicted Effect probably damaging
Transcript: ENSMUST00000056129
AA Change: Y301C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: Y301C

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Meta Mutation Damage Score 0.2132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 4987327 missense possibly damaging 0.93
IGL01865:Npas4 APN 19 4985791 nonsense probably null
IGL02746:Npas4 APN 19 4986667 missense probably damaging 0.99
IGL03061:Npas4 APN 19 4986337 missense probably damaging 1.00
IGL03340:Npas4 APN 19 4985066 utr 3 prime probably benign
R0879:Npas4 UTSW 19 4986916 missense probably benign
R0920:Npas4 UTSW 19 4986316 nonsense probably null
R1751:Npas4 UTSW 19 4988183 missense probably benign 0.05
R1767:Npas4 UTSW 19 4988183 missense probably benign 0.05
R2066:Npas4 UTSW 19 4987414 missense probably damaging 0.99
R2201:Npas4 UTSW 19 4987364 missense probably benign 0.06
R3973:Npas4 UTSW 19 4986551 missense probably benign
R4846:Npas4 UTSW 19 4986777 missense probably benign 0.34
R5007:Npas4 UTSW 19 4989656 missense possibly damaging 0.61
R6155:Npas4 UTSW 19 4986870 missense probably damaging 1.00
R6255:Npas4 UTSW 19 4986375 missense probably damaging 1.00
R6488:Npas4 UTSW 19 4985983 missense probably damaging 1.00
Z1177:Npas4 UTSW 19 4986242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGAGTTTAGCTGCTGGC -3'
(R):5'- GCTCCCTCAATTCAGTGTAGAG -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTCACTGGAAAG -3'
(R):5'- CTCCCTCAATTCAGTGTAGAGGTAAG -3'
Posted On2015-05-14