Incidental Mutation 'R4117:Heph'
ID315150
Institutional Source Beutler Lab
Gene Symbol Heph
Ensembl Gene ENSMUSG00000031209
Gene Namehephaestin
Synonymssla, Cpl, sex linked anemia, C130006F04Rik
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4117 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location96455359-96574485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96500615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 615 (V615A)
Ref Sequence ENSEMBL: ENSMUSP00000078301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033553] [ENSMUST00000079322] [ENSMUST00000113838]
Predicted Effect probably benign
Transcript: ENSMUST00000033553
AA Change: V657A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033553
Gene: ENSMUSG00000031209
AA Change: V657A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Cu-oxidase_3 95 209 6.1e-10 PFAM
Blast:FA58C 252 372 4e-7 BLAST
Pfam:Cu-oxidase_3 450 562 2e-8 PFAM
Pfam:Cu-oxidase_3 806 905 1e-7 PFAM
Pfam:Cu-oxidase_2 942 1065 7.5e-17 PFAM
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1134 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079322
AA Change: V615A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078301
Gene: ENSMUSG00000031209
AA Change: V615A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Cu-oxidase_3 95 209 2.6e-10 PFAM
Blast:FA58C 252 372 3e-7 BLAST
Pfam:Cu-oxidase_3 439 509 6.4e-7 PFAM
internal_repeat_1 688 798 9.28e-22 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113838
AA Change: V657A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109469
Gene: ENSMUSG00000031209
AA Change: V657A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Cu-oxidase_3 96 209 7.5e-10 PFAM
Blast:FA58C 252 372 4e-7 BLAST
Pfam:Cu-oxidase_3 439 562 1.8e-8 PFAM
Pfam:Cu-oxidase_3 806 905 8.2e-8 PFAM
Pfam:Cu-oxidase_2 941 1065 6.3e-16 PFAM
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1134 1143 N/A INTRINSIC
Meta Mutation Damage Score 0.3100 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multicopper oxidase protein family. The encoded protein is involved in the transport of dietary iron from epithelial cells of the intestinal lumen into the circulatory system, and may be involved in copper transport and homeostasis. In mouse, defects in this gene can lead to severe microcytic anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Hemizygous male and homozygous female mutants are small and pale at birth, exhibit a hypochromic anemia which tends to disappear with age. Mutants have impaired iron transport in the placenta and in the gut. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Heph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Heph APN X 96527678 missense probably damaging 1.00
IGL01515:Heph APN X 96558100 missense probably damaging 1.00
IGL02437:Heph APN X 96473027 missense probably benign 0.09
IGL03065:Heph APN X 96527567 missense probably benign 0.35
R0555:Heph UTSW X 96558084 missense probably damaging 1.00
R1864:Heph UTSW X 96529486 missense probably damaging 1.00
R1871:Heph UTSW X 96499084 missense probably benign 0.32
Z1088:Heph UTSW X 96466031 missense probably damaging 1.00
Z1176:Heph UTSW X 96554922 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGCTGATATGCTGCTGAC -3'
(R):5'- TCAAAACCCTGAGCACACTTCTTTC -3'

Sequencing Primer
(F):5'- GCTGCTGACTATGATTTGAGTAGTC -3'
(R):5'- GAGCACACTTCTTTCTTTTCACCAG -3'
Posted On2015-05-14