Incidental Mutation 'R4118:Serpinb3d'
ID315154
Institutional Source Beutler Lab
Gene Symbol Serpinb3d
Ensembl Gene ENSMUSG00000058017
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Synonyms
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location107078167-107083506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107079230 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 249 (D249E)
Ref Sequence ENSEMBL: ENSMUSP00000023861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023861
AA Change: D249E

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023861
Gene: ENSMUSG00000058017
AA Change: D249E

DomainStartEndE-ValueType
SERPIN 13 387 2.44e-169 SMART
Meta Mutation Damage Score 0.1752 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Serpinb3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Serpinb3d APN 1 107079666 missense probably damaging 1.00
IGL01917:Serpinb3d APN 1 107079681 missense probably damaging 1.00
IGL02732:Serpinb3d APN 1 107082796 critical splice acceptor site probably null
IGL02988:Serpinb3d UTSW 1 107078536 missense probably benign
R0540:Serpinb3d UTSW 1 107079232 missense probably benign 0.01
R0594:Serpinb3d UTSW 1 107079347 missense probably damaging 1.00
R1666:Serpinb3d UTSW 1 107080751 missense probably benign 0.18
R1668:Serpinb3d UTSW 1 107080751 missense probably benign 0.18
R1905:Serpinb3d UTSW 1 107079284 missense possibly damaging 0.71
R1994:Serpinb3d UTSW 1 107080788 missense possibly damaging 0.52
R2021:Serpinb3d UTSW 1 107078452 missense probably benign 0.05
R2022:Serpinb3d UTSW 1 107078452 missense probably benign 0.05
R3760:Serpinb3d UTSW 1 107081574 splice site probably benign
R4496:Serpinb3d UTSW 1 107079292 missense probably damaging 0.98
R4770:Serpinb3d UTSW 1 107078278 missense probably damaging 1.00
R4793:Serpinb3d UTSW 1 107078221 missense probably damaging 1.00
R5174:Serpinb3d UTSW 1 107078498 missense possibly damaging 0.63
R5434:Serpinb3d UTSW 1 107078533 missense probably benign 0.02
R5813:Serpinb3d UTSW 1 107079297 missense probably benign 0.14
R5820:Serpinb3d UTSW 1 107078359 missense probably damaging 0.99
R5935:Serpinb3d UTSW 1 107083375 missense probably benign 0.00
R6056:Serpinb3d UTSW 1 107079722 missense probably damaging 1.00
R6092:Serpinb3d UTSW 1 107079259 missense probably damaging 1.00
R6188:Serpinb3d UTSW 1 107078507 missense probably damaging 0.98
R6247:Serpinb3d UTSW 1 107082760 missense probably benign 0.01
R6369:Serpinb3d UTSW 1 107080753 missense probably benign 0.00
R6476:Serpinb3d UTSW 1 107083341 missense probably benign 0.09
R7178:Serpinb3d UTSW 1 107080776 missense possibly damaging 0.72
R7743:Serpinb3d UTSW 1 107079358 missense probably damaging 0.99
R7765:Serpinb3d UTSW 1 107079782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCAGTGTGATTCAGGATG -3'
(R):5'- TGCCTCTGTACAATATTATCTGTCG -3'

Sequencing Primer
(F):5'- TGTGATTCAGGATGTGTGTAAAATAC -3'
(R):5'- CTCCCTTGATATGTGTGTGACATGC -3'
Posted On2015-05-14