Incidental Mutation 'R4118:Gmps'
ID315158
Institutional Source Beutler Lab
Gene Symbol Gmps
Ensembl Gene ENSMUSG00000027823
Gene Nameguanine monophosphate synthetase
SynonymsGm9479
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63976106-64022579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63980194 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000029405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029405]
Predicted Effect probably benign
Transcript: ENSMUST00000029405
AA Change: V29A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029405
Gene: ENSMUSG00000027823
AA Change: V29A

DomainStartEndE-ValueType
Pfam:GATase 29 210 6.3e-42 PFAM
Pfam:Peptidase_C26 91 192 1.9e-14 PFAM
Pfam:NAD_synthase 219 339 2.8e-10 PFAM
Pfam:Asn_synthase 231 315 3.9e-6 PFAM
Pfam:tRNA_Me_trans 237 318 1.1e-6 PFAM
Pfam:QueC 238 353 5.3e-9 PFAM
Pfam:GMP_synt_C 492 692 1.4e-32 PFAM
Meta Mutation Damage Score 0.1350 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the de novo synthesis of purine nucleotides, IMP is the branch point metabolite at which point the pathway diverges to the synthesis of either guanine or adenine nucleotides. In the guanine nucleotide pathway, there are 2 enzymes involved in converting IMP to GMP, namely IMP dehydrogenase (IMPD1), which catalyzes the oxidation of IMP to XMP, and GMP synthetase, which catalyzes the amination of XMP to GMP. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Gmps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Gmps APN 3 64014367 missense probably benign
IGL01341:Gmps APN 3 64015440 missense probably damaging 1.00
IGL01369:Gmps APN 3 64001592 missense probably benign 0.00
IGL02332:Gmps APN 3 63990569 missense probably benign 0.01
IGL02481:Gmps APN 3 64014352 missense probably damaging 1.00
IGL02483:Gmps APN 3 64014352 missense probably damaging 1.00
IGL03173:Gmps APN 3 63990329 missense probably damaging 0.98
K3955:Gmps UTSW 3 64001533 missense probably damaging 1.00
R0089:Gmps UTSW 3 63998698 missense probably benign 0.20
R0165:Gmps UTSW 3 63993954 missense probably damaging 1.00
R0466:Gmps UTSW 3 63993944 missense probably damaging 0.97
R0940:Gmps UTSW 3 63976322 splice site probably benign
R1686:Gmps UTSW 3 63985654 missense probably damaging 1.00
R1872:Gmps UTSW 3 64001517 missense probably benign 0.15
R1924:Gmps UTSW 3 63998628 missense probably damaging 1.00
R2229:Gmps UTSW 3 64014263 nonsense probably null
R3014:Gmps UTSW 3 64015436 missense possibly damaging 0.79
R3800:Gmps UTSW 3 63982445 missense possibly damaging 0.48
R4293:Gmps UTSW 3 63990619 missense probably damaging 0.99
R4596:Gmps UTSW 3 63993917 nonsense probably null
R4665:Gmps UTSW 3 64001535 missense probably benign 0.11
R5032:Gmps UTSW 3 63990325 missense probably benign 0.01
R6045:Gmps UTSW 3 63980137 missense probably benign
R6153:Gmps UTSW 3 64001543 missense probably benign 0.00
R6985:Gmps UTSW 3 64015539 missense probably damaging 1.00
R7188:Gmps UTSW 3 64011561 missense probably damaging 0.97
R7523:Gmps UTSW 3 64011666 missense possibly damaging 0.78
R7724:Gmps UTSW 3 63985653 missense possibly damaging 0.85
R7819:Gmps UTSW 3 63985627 missense probably damaging 1.00
R7849:Gmps UTSW 3 64015563 missense probably benign 0.33
R7932:Gmps UTSW 3 64015563 missense probably benign 0.33
X0063:Gmps UTSW 3 63996850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTCTGTCTGGTGGAGC -3'
(R):5'- GTAATCTCCCCAGCAGCATC -3'

Sequencing Primer
(F):5'- GGACAGCTTACAGGAATTGCTTCTC -3'
(R):5'- GGAAATTTCTTACAAAATTACGCTGG -3'
Posted On2015-05-14