Incidental Mutation 'R4118:Bbs4'
ID315173
Institutional Source Beutler Lab
Gene Symbol Bbs4
Ensembl Gene ENSMUSG00000025235
Gene NameBardet-Biedl syndrome 4 (human)
SynonymsD9Ertd464e
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59321990-59353508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59330425 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 212 (Y212C)
Ref Sequence ENSEMBL: ENSMUSP00000026265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026265]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026265
AA Change: Y212C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026265
Gene: ENSMUSG00000025235
AA Change: Y212C

DomainStartEndE-ValueType
TPR 67 100 1.64e1 SMART
TPR 101 134 1.14e1 SMART
TPR 135 168 5.19e-3 SMART
TPR 169 201 3.67e-3 SMART
TPR 202 235 9.68e-3 SMART
TPR 270 303 1.26e-1 SMART
TPR 304 337 2.38e-2 SMART
TPR 338 371 1.64e1 SMART
low complexity region 490 504 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214832
Predicted Effect probably benign
Transcript: ENSMUST00000217367
Meta Mutation Damage Score 0.8684 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity and polyphagia after weaning, retinal degeneration, male infertility, absence of sperm cell flagella, renal abnormalities, impaired olfaction, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Bbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Bbs4 APN 9 59324065 missense probably benign 0.00
IGL01360:Bbs4 APN 9 59339848 missense possibly damaging 0.89
IGL02005:Bbs4 APN 9 59336355 splice site probably benign
IGL02150:Bbs4 APN 9 59336368 missense probably benign
IGL02278:Bbs4 APN 9 59341168 missense possibly damaging 0.64
IGL02402:Bbs4 APN 9 59330446 missense probably benign 0.41
IGL02593:Bbs4 APN 9 59328597 missense probably damaging 0.99
IGL03328:Bbs4 APN 9 59344118 missense probably damaging 1.00
R0964:Bbs4 UTSW 9 59322976 makesense probably null
R1298:Bbs4 UTSW 9 59339813 missense probably damaging 1.00
R1944:Bbs4 UTSW 9 59330415 splice site probably null
R2986:Bbs4 UTSW 9 59341195 missense probably damaging 1.00
R4701:Bbs4 UTSW 9 59323519 missense probably benign
R6930:Bbs4 UTSW 9 59323481 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAATGTTAGTTCCCTTAGCAAC -3'
(R):5'- GATTGCCAAACTGCTCTCAG -3'

Sequencing Primer
(F):5'- CGAGTATATAAAACAAACCAGGGTTC -3'
(R):5'- TTTAATCCCAGCACTCAGGAGG -3'
Posted On2015-05-14