Incidental Mutation 'R4118:Dek'
ID315185
Institutional Source Beutler Lab
Gene Symbol Dek
Ensembl Gene ENSMUSG00000021377
Gene NameDEK oncogene (DNA binding)
SynonymsD13H6S231E, 1810019E15Rik
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47084775-47106201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47088600 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 201 (T201A)
Ref Sequence ENSEMBL: ENSMUSP00000121663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021807] [ENSMUST00000037025] [ENSMUST00000135278] [ENSMUST00000224150]
Predicted Effect unknown
Transcript: ENSMUST00000021807
AA Change: T264A
SMART Domains Protein: ENSMUSP00000021807
Gene: ENSMUSG00000021377
AA Change: T264A

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 315 N/A INTRINSIC
Pfam:DEK_C 327 379 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128977
Predicted Effect probably benign
Transcript: ENSMUST00000135278
AA Change: T201A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121663
Gene: ENSMUSG00000021377
AA Change: T201A

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138401
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224150
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed development of DMBA- and TPA-induced papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Dek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Dek APN 13 47088135 missense probably benign 0.37
R1438:Dek UTSW 13 47088171 missense probably benign 0.23
R5235:Dek UTSW 13 47086479 unclassified probably null
R5847:Dek UTSW 13 47101601 unclassified probably benign
R6285:Dek UTSW 13 47099380 missense probably damaging 1.00
R6736:Dek UTSW 13 47099390 missense probably damaging 1.00
R6903:Dek UTSW 13 47098187 missense possibly damaging 0.83
R7120:Dek UTSW 13 47100183 missense unknown
R7359:Dek UTSW 13 47105589 missense unknown
R7372:Dek UTSW 13 47105577 missense unknown
R7504:Dek UTSW 13 47088035 missense probably damaging 1.00
RF016:Dek UTSW 13 47098186 nonsense probably null
Z1177:Dek UTSW 13 47105626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATATGCTGCACGCTGACAG -3'
(R):5'- ACAAAATGCTGTACCCGTTTCC -3'

Sequencing Primer
(F):5'- TGCACGCTGACAGTTGCTG -3'
(R):5'- ACTAAGCGCTCTTTTAGAAGTGAGG -3'
Posted On2015-05-14