Incidental Mutation 'R4118:Tlr11'
ID315191
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Nametoll-like receptor 11
SynonymsLOC239081
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50357914-50363663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50363227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 890 (Y890C)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
Predicted Effect probably damaging
Transcript: ENSMUST00000063570
AA Change: Y885C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: Y885C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185091
AA Change: Y890C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: Y890C

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2023:Tlr11 UTSW 14 50362569 missense probably damaging 0.96
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4365:Tlr11 UTSW 14 50361469 missense probably damaging 0.98
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5349:Tlr11 UTSW 14 50360880 missense probably benign 0.45
R5606:Tlr11 UTSW 14 50362260 missense probably benign 0.08
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6484:Tlr11 UTSW 14 50362678 missense probably damaging 0.99
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R6717:Tlr11 UTSW 14 50362104 missense probably benign
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
R7241:Tlr11 UTSW 14 50362141 missense possibly damaging 0.95
R7440:Tlr11 UTSW 14 50361344 missense probably benign 0.00
R7482:Tlr11 UTSW 14 50362999 missense probably damaging 0.99
R7582:Tlr11 UTSW 14 50361729 nonsense probably null
R7790:Tlr11 UTSW 14 50361925 missense probably benign
R7818:Tlr11 UTSW 14 50361828 missense probably damaging 1.00
R7827:Tlr11 UTSW 14 50361154 missense probably benign 0.00
RF002:Tlr11 UTSW 14 50361225 missense possibly damaging 0.63
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Z1176:Tlr11 UTSW 14 50360662 missense probably damaging 1.00
Z1176:Tlr11 UTSW 14 50362336 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTTTGGGATTGGAAATGACAGG -3'
(R):5'- ATGAGAGCACATTCCCTCTGC -3'

Sequencing Primer
(F):5'- TGGAATCCATGATTGCCAGC -3'
(R):5'- GCTGCTGAAAGGATCTTCTGCAC -3'
Posted On2015-05-14