Incidental Mutation 'R4118:Vmn2r91'
ID315197
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18110096 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 547 (N547K)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably damaging
Transcript: ENSMUST00000172359
AA Change: N547K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: N547K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Nat2 G A 8: 67,501,619 R127H possibly damaging Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTAGGTGTTAACAACAGTACTTTGC -3'
(R):5'- GTGGCACTGTCCAATGTAAAG -3'

Sequencing Primer
(F):5'- ACAACAGTACTTTGCTTTTCAGTG -3'
(R):5'- ATGATTTGCAATGGCTATTTTGAGC -3'
Posted On2015-05-14