Mutagenetix > Incidental Mutations

Incidental Mutation 'R4119:Cenpf'

315207

Institutional Source

Beutler Lab

Gene Symbol

Cenpf

Ensembl Gene

ENSMUSG00000026605

Gene Name

centromere protein F

Synonyms

mitosin, 6530404A22Rik, Lek1

MMRRC Submission

040992-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.616) question?

Stock #

R4119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

189640606-189688086 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 189653045 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2346 (I2346T)

Ref Sequence

ENSEMBL: ENSMUSP00000129738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171929]

Predicted Effect

probably benign
Transcript: ENSMUST00000165798

SMART Domains

Protein: ENSMUSP00000132430
Gene: ENSMUSG00000026605

Domain	Start	End	E-Value	Type
Pfam:CENP-F_C_Rb_bdg	23	50	1.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171929
AA Change: I2346T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: I2346T

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	2.8e-144	PFAM
low complexity region	349	364	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	589	609	N/A	INTRINSIC
internal_repeat_5	678	707	8.32e-5	PROSPERO
internal_repeat_3	743	798	2.21e-5	PROSPERO
internal_repeat_1	780	812	2.12e-7	PROSPERO
coiled coil region	829	881	N/A	INTRINSIC
coiled coil region	902	1169	N/A	INTRINSIC
coiled coil region	1206	1364	N/A	INTRINSIC
internal_repeat_2	1381	1413	3.02e-6	PROSPERO
internal_repeat_3	1412	1470	2.21e-5	PROSPERO
low complexity region	1526	1542	N/A	INTRINSIC
coiled coil region	1560	1650	N/A	INTRINSIC
internal_repeat_2	1655	1687	3.02e-6	PROSPERO
low complexity region	1744	1755	N/A	INTRINSIC
coiled coil region	1822	1852	N/A	INTRINSIC
Pfam:CENP-F_leu_zip	1893	2035	1.2e-14	PFAM
Pfam:CENP-F_leu_zip	2131	2270	1.5e-47	PFAM
Pfam:CENP-F_leu_zip	2313	2449	1e-46	PFAM
low complexity region	2544	2555	N/A	INTRINSIC
low complexity region	2642	2654	N/A	INTRINSIC
low complexity region	2755	2769	N/A	INTRINSIC
internal_repeat_4	2778	2801	4.28e-5	PROSPERO
low complexity region	2837	2847	N/A	INTRINSIC
Pfam:CENP-F_C_Rb_bdg	2850	2896	6.6e-29	PFAM
internal_repeat_1	2935	2964	2.12e-7	PROSPERO
internal_repeat_4	2946	2969	4.28e-5	PROSPERO

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	G	6: 124,356,904	L39P	probably damaging	Het
Abcc1	A	G	16: 14,394,013	M138V	probably benign	Het
Abl1	T	A	2: 31,801,727	I1067N	probably damaging	Het
Adam6a	C	T	12: 113,544,574	T189I	probably benign	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aplnr	T	C	2: 85,136,966	Y112H	possibly damaging	Het
Arhgap17	A	G	7: 123,306,994	F313S	probably damaging	Het
Arid1b	T	C	17: 4,995,794		probably benign	Het
Bcas1	G	C	2: 170,378,815	P394A	probably benign	Het
Ccdc116	A	G	16: 17,142,187	S213P	probably damaging	Het
Cdh15	T	C	8: 122,863,423	V365A	probably damaging	Het
Chd7	A	G	4: 8,785,658		probably benign	Het
Ezh2	A	C	6: 47,544,548	N390K	probably benign	Het
Fbxo7	C	A	10: 86,021,895		probably benign	Het
Fibin	A	G	2: 110,362,690	Y36H	probably damaging	Het
Gm597	A	T	1: 28,777,973	V326D	probably damaging	Het
Gpr37	C	T	6: 25,688,426	R224H	possibly damaging	Het
Hars2	A	T	18: 36,790,488	N363I	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Itpr1	G	A	6: 108,394,355	D1140N	probably benign	Het
Lrig2	A	G	3: 104,467,195	V190A	probably benign	Het
Ltk	T	A	2: 119,757,948		probably benign	Het
Morc2a	C	A	11: 3,683,868	T660N	probably benign	Het
Msh3	A	G	13: 92,354,011		probably benign	Het
Myo15b	T	C	11: 115,873,492	S1311P	probably benign	Het
Nbeal1	A	T	1: 60,291,870	I2213L	probably damaging	Het
Olfr1122	T	A	2: 87,387,843	M46K	possibly damaging	Het
Olfr1155	A	G	2: 87,943,443	Y62H	probably damaging	Het
P2ry12	T	C	3: 59,217,841	T138A	probably benign	Het
Pirb	T	C	7: 3,717,575	D308G	probably damaging	Het
Pkn3	A	G	2: 30,083,037		probably benign	Het
Ripor1	T	A	8: 105,618,857		probably benign	Het
Ryr2	T	C	13: 11,779,267	T942A	probably benign	Het
Sptbn5	T	A	2: 120,064,529	D798V	possibly damaging	Het
Synpo2	T	A	3: 123,117,150	D282V	probably damaging	Het
Tnik	T	C	3: 28,666,175	F1287L	probably damaging	Het
Tshz1	T	G	18: 84,014,189	K698T	probably benign	Het
Ttc23l	A	C	15: 10,539,920	V159G	probably damaging	Het
Urb2	T	A	8: 124,047,240	D1503E	probably benign	Het
Usp29	T	A	7: 6,962,806	N549K	probably benign	Het
Vmn2r39	G	A	7: 9,023,674	H443Y	probably benign	Het
Zfp24	A	G	18: 24,014,569	Y229H	possibly damaging	Het
Zfp472	T	A	17: 32,978,215	Y421*	probably null	Het
Zkscan3	T	C	13: 21,393,949	E256G	possibly damaging	Het

Other mutations in Cenpf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cenpf	APN	1	189654912	missense	probably benign	0.01
IGL01154:Cenpf	APN	1	189680333	missense	probably benign	0.19
IGL01434:Cenpf	APN	1	189657868	nonsense	probably null
IGL01461:Cenpf	APN	1	189657096	missense	probably damaging	1.00
IGL01615:Cenpf	APN	1	189653184	missense	possibly damaging	0.68
IGL01720:Cenpf	APN	1	189682386	missense	probably benign	0.05
IGL01720:Cenpf	APN	1	189651215	missense	probably damaging	0.99
IGL01803:Cenpf	APN	1	189654771	nonsense	probably null
IGL02152:Cenpf	APN	1	189649012	missense	probably benign
IGL02222:Cenpf	APN	1	189654444	missense	probably benign
IGL02338:Cenpf	APN	1	189680418	missense	probably damaging	1.00
IGL02580:Cenpf	APN	1	189657441	missense	probably benign	0.20
IGL02629:Cenpf	APN	1	189652334	missense	probably damaging	1.00
IGL02650:Cenpf	APN	1	189652473	missense	possibly damaging	0.91
IGL02660:Cenpf	APN	1	189654782	missense	probably damaging	1.00
IGL02703:Cenpf	APN	1	189659758	missense	probably benign	0.14
IGL02809:Cenpf	APN	1	189682358	splice site	probably benign
IGL02851:Cenpf	APN	1	189658030	missense	probably damaging	1.00
IGL02903:Cenpf	APN	1	189646876	missense	probably damaging	0.99
IGL03126:Cenpf	APN	1	189659010	missense	probably damaging	1.00
IGL03235:Cenpf	APN	1	189683927	missense	probably damaging	1.00
IGL03336:Cenpf	APN	1	189652647	missense	probably damaging	0.99
IGL03402:Cenpf	APN	1	189655076	missense	probably damaging	1.00
IGL02799:Cenpf	UTSW	1	189659652	missense	probably damaging	1.00
R0011:Cenpf	UTSW	1	189650706	missense	probably benign	0.05
R0129:Cenpf	UTSW	1	189659650	missense	probably benign	0.26
R0157:Cenpf	UTSW	1	189652359	missense	probably benign	0.07
R0270:Cenpf	UTSW	1	189650714	missense	probably benign	0.01
R0607:Cenpf	UTSW	1	189682463	splice site	probably null
R0621:Cenpf	UTSW	1	189672628	missense	probably benign
R0639:Cenpf	UTSW	1	189658062	missense	probably benign	0.01
R0653:Cenpf	UTSW	1	189659986	missense	probably damaging	1.00
R0718:Cenpf	UTSW	1	189653984	missense	probably damaging	1.00
R1157:Cenpf	UTSW	1	189658453	missense	probably benign	0.20
R1331:Cenpf	UTSW	1	189642801	missense	probably damaging	0.99
R1463:Cenpf	UTSW	1	189654739	missense	probably damaging	0.97
R1514:Cenpf	UTSW	1	189679141	missense	possibly damaging	0.67
R1529:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1662:Cenpf	UTSW	1	189657771	missense	probably damaging	0.99
R1671:Cenpf	UTSW	1	189679144	splice site	probably null
R1725:Cenpf	UTSW	1	189680479	missense	probably damaging	0.99
R1743:Cenpf	UTSW	1	189654263	missense	probably benign	0.19
R1874:Cenpf	UTSW	1	189683816	missense	probably damaging	1.00
R1884:Cenpf	UTSW	1	189646849	missense	probably benign
R1980:Cenpf	UTSW	1	189653915	missense	probably benign	0.04
R2074:Cenpf	UTSW	1	189656901	missense	probably damaging	1.00
R2096:Cenpf	UTSW	1	189653459	missense	possibly damaging	0.95
R2109:Cenpf	UTSW	1	189679067	missense	probably damaging	0.99
R2113:Cenpf	UTSW	1	189679102	missense	probably damaging	0.96
R2134:Cenpf	UTSW	1	189658642	missense	probably benign	0.03
R2209:Cenpf	UTSW	1	189652598	missense	probably benign	0.04
R2875:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R2876:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R3433:Cenpf	UTSW	1	189659949	missense	probably damaging	0.99
R3709:Cenpf	UTSW	1	189648812	missense	possibly damaging	0.72
R3786:Cenpf	UTSW	1	189658337	missense	probably damaging	1.00
R4014:Cenpf	UTSW	1	189653159	missense	probably benign	0.01
R4108:Cenpf	UTSW	1	189683868	missense	probably damaging	1.00
R4177:Cenpf	UTSW	1	189668619	missense	possibly damaging	0.95
R4422:Cenpf	UTSW	1	189658350	missense	probably damaging	1.00
R4546:Cenpf	UTSW	1	189654650	missense	probably damaging	1.00
R4592:Cenpf	UTSW	1	189679033	missense	probably damaging	1.00
R4643:Cenpf	UTSW	1	189659589	missense	probably benign	0.00
R4650:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R4801:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4802:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4817:Cenpf	UTSW	1	189682369	missense	possibly damaging	0.93
R4871:Cenpf	UTSW	1	189658531	missense	probably damaging	1.00
R5037:Cenpf	UTSW	1	189683846	missense	probably damaging	1.00
R5106:Cenpf	UTSW	1	189683808	missense	probably benign	0.00
R5208:Cenpf	UTSW	1	189671046	critical splice donor site	probably null
R5213:Cenpf	UTSW	1	189654980	missense	probably benign	0.04
R5237:Cenpf	UTSW	1	189659533	missense	probably benign	0.28
R5255:Cenpf	UTSW	1	189672627	missense	possibly damaging	0.49
R5378:Cenpf	UTSW	1	189653466	missense	possibly damaging	0.95
R5468:Cenpf	UTSW	1	189652371	missense	probably damaging	1.00
R5510:Cenpf	UTSW	1	189682903	missense	probably benign	0.14
R5616:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R5652:Cenpf	UTSW	1	189657082	missense	probably damaging	0.99
R5735:Cenpf	UTSW	1	189654363	missense	probably benign	0.10
R5841:Cenpf	UTSW	1	189657444	missense	possibly damaging	0.90
R5943:Cenpf	UTSW	1	189659969	missense	possibly damaging	0.75
R6082:Cenpf	UTSW	1	189658104	missense	probably benign	0.11
R6108:Cenpf	UTSW	1	189662013	missense	probably benign	0.03
R6269:Cenpf	UTSW	1	189659920	missense	probably benign	0.37
R6284:Cenpf	UTSW	1	189652742	missense	probably damaging	1.00
R6425:Cenpf	UTSW	1	189659898	missense	probably benign	0.09
R6587:Cenpf	UTSW	1	189658374	missense	probably damaging	1.00
R6747:Cenpf	UTSW	1	189652854	missense	probably benign	0.15
R6811:Cenpf	UTSW	1	189654542	missense	probably benign	0.06
R6834:Cenpf	UTSW	1	189659446	missense	probably damaging	1.00
R6951:Cenpf	UTSW	1	189653792	missense	probably damaging	1.00
R7095:Cenpf	UTSW	1	189659176	missense	probably benign	0.01
R7128:Cenpf	UTSW	1	189684991	missense	probably damaging	1.00
R7185:Cenpf	UTSW	1	189653489	missense	probably damaging	1.00
R7292:Cenpf	UTSW	1	189650694	missense	probably damaging	1.00
R7353:Cenpf	UTSW	1	189654138	nonsense	probably null
R7402:Cenpf	UTSW	1	189659378	nonsense	probably null
R7460:Cenpf	UTSW	1	189654050	missense	probably damaging	0.97
R7484:Cenpf	UTSW	1	189656821	missense	probably damaging	1.00
R7574:Cenpf	UTSW	1	189658667	missense	probably damaging	1.00
R7691:Cenpf	UTSW	1	189658207	nonsense	probably null
R7698:Cenpf	UTSW	1	189662072	missense	probably benign	0.01
R7901:Cenpf	UTSW	1	189657248	missense	probably damaging	1.00
R7941:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R8007:Cenpf	UTSW	1	189646947	missense
R8194:Cenpf	UTSW	1	189682403	missense	probably benign	0.06
R8420:Cenpf	UTSW	1	189672585	missense	probably damaging	1.00
R8429:Cenpf	UTSW	1	189657307	missense	possibly damaging	0.72
R8477:Cenpf	UTSW	1	189653188	missense	probably benign
R8492:Cenpf	UTSW	1	189658729	missense	probably damaging	0.99
R8510:Cenpf	UTSW	1	189650706	missense	probably benign	0.01
R8686:Cenpf	UTSW	1	189659604	missense	probably benign	0.00
R8696:Cenpf	UTSW	1	189657997	missense	probably benign	0.20
R8855:Cenpf	UTSW	1	189653233	missense	probably benign	0.11
R8901:Cenpf	UTSW	1	189662051	missense	probably benign	0.30
R8958:Cenpf	UTSW	1	189653153	missense	possibly damaging	0.81
RF006:Cenpf	UTSW	1	189657386	missense	probably damaging	1.00
X0025:Cenpf	UTSW	1	189653874	missense	possibly damaging	0.79
X0066:Cenpf	UTSW	1	189657929	missense	probably benign	0.23
Z1088:Cenpf	UTSW	1	189652931	missense	probably damaging	1.00
Z1176:Cenpf	UTSW	1	189659472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCAGATACTCGCTCTTGCTC -3'
(R):5'- CCTTGTGTAATGACCAAGAAACCTTG -3'

Sequencing Primer
(F):5'- ACTGCAAGTCTTGGAGGT -3'
(R):5'- CTTGAAGGCCCAAGAACAGAGTC -3'

Posted On

2015-05-14