Incidental Mutation 'R4119:Olfr1155'
ID315212
Institutional Source Beutler Lab
Gene Symbol Olfr1155
Ensembl Gene ENSMUSG00000075145
Gene Nameolfactory receptor 1155
SynonymsGA_x6K02T2Q125-49426894-49425950, MOR174-10
MMRRC Submission 040992-MU
Accession Numbers

Genbank: NM_146643; MGI: 3030989

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87941645-87945137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87943443 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 62 (Y62H)
Ref Sequence ENSEMBL: ENSMUSP00000149428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099843] [ENSMUST00000214641] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect probably damaging
Transcript: ENSMUST00000099843
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097431
Gene: ENSMUSG00000075145
AA Change: Y62H

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.7e-44 PFAM
Pfam:7tm_1 43 292 5.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214641
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215903
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216191
Predicted Effect probably benign
Transcript: ENSMUST00000216726
Meta Mutation Damage Score 0.1507 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Olfr1155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Olfr1155 APN 2 87942918 nonsense probably null
IGL03245:Olfr1155 APN 2 87942742 missense possibly damaging 0.75
B5639:Olfr1155 UTSW 2 87943598 missense probably benign 0.03
PIT4531001:Olfr1155 UTSW 2 87943227 missense probably damaging 1.00
R0212:Olfr1155 UTSW 2 87943091 missense probably damaging 1.00
R0393:Olfr1155 UTSW 2 87943565 missense possibly damaging 0.62
R1178:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1180:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1181:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1266:Olfr1155 UTSW 2 87943533 missense probably benign 0.01
R1847:Olfr1155 UTSW 2 87942721 splice site probably null
R1998:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R2000:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R4213:Olfr1155 UTSW 2 87943121 missense probably benign 0.00
R5157:Olfr1155 UTSW 2 87942888 missense probably benign
R5688:Olfr1155 UTSW 2 87943208 missense probably benign 0.02
R5731:Olfr1155 UTSW 2 87943427 missense possibly damaging 0.89
R6064:Olfr1155 UTSW 2 87943484 missense probably benign 0.00
R6372:Olfr1155 UTSW 2 87942975 missense probably benign 0.00
R6505:Olfr1155 UTSW 2 87943174 nonsense probably null
R6555:Olfr1155 UTSW 2 87943288 missense probably damaging 1.00
R6909:Olfr1155 UTSW 2 87942690 missense probably benign 0.27
R7257:Olfr1155 UTSW 2 87943571 missense probably damaging 1.00
R8037:Olfr1155 UTSW 2 87942975 missense probably benign 0.00
R8367:Olfr1155 UTSW 2 87943097 missense possibly damaging 0.75
Z1088:Olfr1155 UTSW 2 87943448 missense probably damaging 1.00
Z1176:Olfr1155 UTSW 2 87943209 missense possibly damaging 0.57
Z1176:Olfr1155 UTSW 2 87943467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCGGTCATAGGCCATC -3'
(R):5'- TTCAGATCTCACCAGAAGACATCATG -3'

Sequencing Primer
(F):5'- GGTCATAGGCCATCACAGC -3'
(R):5'- TCTCACCAGAAGACATCATGATTCTG -3'
Posted On2015-05-14