Incidental Mutation 'R4119:Ltk'
ID315214
Institutional Source Beutler Lab
Gene Symbol Ltk
Ensembl Gene ENSMUSG00000027297
Gene Nameleukocyte tyrosine kinase
Synonyms
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score153
Status Validated
Chromosome2
Chromosomal Location119751320-119760431 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 119757948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028759] [ENSMUST00000028759] [ENSMUST00000082130] [ENSMUST00000140224] [ENSMUST00000182203]
Predicted Effect probably benign
Transcript: ENSMUST00000028759
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028759
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082130
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134295
Predicted Effect probably benign
Transcript: ENSMUST00000140224
SMART Domains Protein: ENSMUSP00000123020
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 1.2e-129 SMART
low complexity region 512 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182203
SMART Domains Protein: ENSMUSP00000138201
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 2.61e-127 SMART
low complexity region 512 529 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ros/insulin receptor family of tyrosine kinases. Tyrosine-specific phosphorylation of proteins is a key to the control of diverse pathways leading to cell growth and differentiation. Four alternatively spliced transcript variants encoding different isoforms have been described for this gene. These transcripts are expressed in a tissue-specific manner in lymphocytes, brain and neuroblastoma cells, and the encoded isoforms exhibit different subcellular localization. The lymphocyte and brain specific variants initiate translation at non-AUG (CUG) start codons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Ltk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ltk APN 2 119755605 splice site probably benign
IGL01287:Ltk APN 2 119755705 missense probably benign 0.26
IGL01339:Ltk APN 2 119752974 missense probably damaging 1.00
IGL01614:Ltk APN 2 119753487 missense probably damaging 1.00
IGL01827:Ltk APN 2 119752738 missense probably damaging 1.00
IGL02229:Ltk APN 2 119758573 missense probably benign 0.01
Envy UTSW 2 119753035 splice site probably null
R2105:Ltk UTSW 2 119752088 missense probably damaging 1.00
R3763:Ltk UTSW 2 119751837 missense probably benign 0.01
R4120:Ltk UTSW 2 119757948 intron probably benign
R4257:Ltk UTSW 2 119753004 missense possibly damaging 0.52
R4460:Ltk UTSW 2 119755613 critical splice donor site probably null
R4888:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5121:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5696:Ltk UTSW 2 119759599 missense probably benign 0.00
R5784:Ltk UTSW 2 119754359 nonsense probably null
R6301:Ltk UTSW 2 119751757 missense probably damaging 1.00
R6470:Ltk UTSW 2 119753035 splice site probably null
R6860:Ltk UTSW 2 119754594 nonsense probably null
R7083:Ltk UTSW 2 119752074 missense probably damaging 1.00
R8537:Ltk UTSW 2 119758107 missense probably benign 0.10
R8861:Ltk UTSW 2 119759613 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAATACTTCTGCCTCCAGC -3'
(R):5'- ATCTTCCGGGTAGGTGCAC -3'

Sequencing Primer
(F):5'- TGGTCAGACCTCCTTTGT -3'
(R):5'- CTTGCTGTCGCTTCGCAGG -3'
Posted On2015-05-14