Incidental Mutation 'R4119:Sptbn5'
ID 315215
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Name spectrin beta, non-erythrocytic 5
Synonyms Spnb5, EG640524
MMRRC Submission 040992-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.225) question?
Stock # R4119 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119871974-119916159 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119895010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 798 (D798V)
Ref Sequence ENSEMBL: ENSMUSP00000106384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110756]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110756
AA Change: D798V

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106384
Gene: ENSMUSG00000074899
AA Change: D798V

DomainStartEndE-ValueType
SPEC 13 111 6.45e-8 SMART
Blast:SPEC 117 206 9e-12 BLAST
SPEC 219 323 3.76e-1 SMART
SPEC 325 425 3.48e-13 SMART
SPEC 431 530 1.09e-5 SMART
SPEC 536 631 1.22e-1 SMART
SPEC 637 737 1.78e-10 SMART
SPEC 743 837 4.73e-15 SMART
SPEC 843 944 4.24e-17 SMART
SPEC 950 1051 1.36e-15 SMART
Blast:SPEC 1057 1130 2e-40 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,333,863 (GRCm39) L39P probably damaging Het
Abcc1 A G 16: 14,211,877 (GRCm39) M138V probably benign Het
Abl1 T A 2: 31,691,739 (GRCm39) I1067N probably damaging Het
Adam6a C T 12: 113,508,194 (GRCm39) T189I probably benign Het
Ankfy1 G A 11: 72,605,310 (GRCm39) probably null Het
Aplnr T C 2: 84,967,310 (GRCm39) Y112H possibly damaging Het
Arhgap17 A G 7: 122,906,217 (GRCm39) F313S probably damaging Het
Arid1b T C 17: 5,046,069 (GRCm39) probably benign Het
Bcas1 G C 2: 170,220,735 (GRCm39) P394A probably benign Het
Ccdc116 A G 16: 16,960,051 (GRCm39) S213P probably damaging Het
Cdh15 T C 8: 123,590,162 (GRCm39) V365A probably damaging Het
Cenpf A G 1: 189,385,242 (GRCm39) I2346T probably benign Het
Chd7 A G 4: 8,785,658 (GRCm39) probably benign Het
Ezh2 A C 6: 47,521,482 (GRCm39) N390K probably benign Het
Fbxo7 C A 10: 85,857,759 (GRCm39) probably benign Het
Fibin A G 2: 110,193,035 (GRCm39) Y36H probably damaging Het
Gpr37 C T 6: 25,688,425 (GRCm39) R224H possibly damaging Het
Hars2 A T 18: 36,923,541 (GRCm39) N363I probably damaging Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Itpr1 G A 6: 108,371,316 (GRCm39) D1140N probably benign Het
Lrig2 A G 3: 104,374,511 (GRCm39) V190A probably benign Het
Ltk T A 2: 119,588,429 (GRCm39) probably benign Het
Morc2a C A 11: 3,633,868 (GRCm39) T660N probably benign Het
Msh3 A G 13: 92,490,519 (GRCm39) probably benign Het
Myo15b T C 11: 115,764,318 (GRCm39) S1311P probably benign Het
Nbeal1 A T 1: 60,331,029 (GRCm39) I2213L probably damaging Het
Or10ag57 T A 2: 87,218,187 (GRCm39) M46K possibly damaging Het
Or5d16 A G 2: 87,773,787 (GRCm39) Y62H probably damaging Het
P2ry12 T C 3: 59,125,262 (GRCm39) T138A probably benign Het
Pirb T C 7: 3,720,574 (GRCm39) D308G probably damaging Het
Pkn3 A G 2: 29,973,049 (GRCm39) probably benign Het
Ripor1 T A 8: 106,345,489 (GRCm39) probably benign Het
Ryr2 T C 13: 11,794,153 (GRCm39) T942A probably benign Het
Spata31e5 A T 1: 28,817,054 (GRCm39) V326D probably damaging Het
Synpo2 T A 3: 122,910,799 (GRCm39) D282V probably damaging Het
Tnik T C 3: 28,720,324 (GRCm39) F1287L probably damaging Het
Tshz1 T G 18: 84,032,314 (GRCm39) K698T probably benign Het
Ttc23l A C 15: 10,540,006 (GRCm39) V159G probably damaging Het
Urb2 T A 8: 124,773,979 (GRCm39) D1503E probably benign Het
Usp29 T A 7: 6,965,805 (GRCm39) N549K probably benign Het
Vmn2r39 G A 7: 9,026,673 (GRCm39) H443Y probably benign Het
Zfp24 A G 18: 24,147,626 (GRCm39) Y229H possibly damaging Het
Zfp472 T A 17: 33,197,189 (GRCm39) Y421* probably null Het
Zkscan3 T C 13: 21,578,119 (GRCm39) E256G possibly damaging Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 119,884,948 (GRCm39) unclassified probably benign
IGL01552:Sptbn5 APN 2 119,884,903 (GRCm39) unclassified probably benign
IGL01800:Sptbn5 APN 2 119,886,908 (GRCm39) unclassified probably benign
IGL02156:Sptbn5 APN 2 119,878,098 (GRCm39) unclassified probably benign
R0020:Sptbn5 UTSW 2 119,896,112 (GRCm39) missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 119,893,156 (GRCm39) splice site probably null
R1121:Sptbn5 UTSW 2 119,899,871 (GRCm39) splice site probably null
R1223:Sptbn5 UTSW 2 119,902,525 (GRCm39) missense probably damaging 0.99
R1405:Sptbn5 UTSW 2 119,881,097 (GRCm39) splice site noncoding transcript
R1852:Sptbn5 UTSW 2 119,902,125 (GRCm39) missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 119,900,943 (GRCm39) missense probably benign 0.00
R2570:Sptbn5 UTSW 2 119,879,121 (GRCm39) exon noncoding transcript
R3898:Sptbn5 UTSW 2 119,887,691 (GRCm39) exon noncoding transcript
R3976:Sptbn5 UTSW 2 119,878,742 (GRCm39) splice site noncoding transcript
R4092:Sptbn5 UTSW 2 119,897,532 (GRCm39) missense probably damaging 0.99
R4120:Sptbn5 UTSW 2 119,895,010 (GRCm39) missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 119,913,680 (GRCm39) exon noncoding transcript
R4352:Sptbn5 UTSW 2 119,913,680 (GRCm39) exon noncoding transcript
R4364:Sptbn5 UTSW 2 119,899,136 (GRCm39) missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 119,896,475 (GRCm39) missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 119,897,927 (GRCm39) splice site probably null
R4616:Sptbn5 UTSW 2 119,879,238 (GRCm39) exon noncoding transcript
R4687:Sptbn5 UTSW 2 119,907,689 (GRCm39) unclassified probably benign
R4693:Sptbn5 UTSW 2 119,889,897 (GRCm39) unclassified probably benign
R4762:Sptbn5 UTSW 2 119,907,703 (GRCm39) unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 119,889,622 (GRCm39) unclassified probably benign
R4818:Sptbn5 UTSW 2 119,898,449 (GRCm39) missense probably benign 0.05
R4822:Sptbn5 UTSW 2 119,898,449 (GRCm39) missense probably benign 0.05
R4825:Sptbn5 UTSW 2 119,886,374 (GRCm39) unclassified probably benign
R4933:Sptbn5 UTSW 2 119,880,601 (GRCm39) exon noncoding transcript
R4970:Sptbn5 UTSW 2 119,882,258 (GRCm39) exon noncoding transcript
R5141:Sptbn5 UTSW 2 119,892,212 (GRCm39) missense probably benign 0.03
R5209:Sptbn5 UTSW 2 119,902,483 (GRCm39) missense probably benign 0.09
R5225:Sptbn5 UTSW 2 119,915,812 (GRCm39) unclassified probably benign
R5227:Sptbn5 UTSW 2 119,915,812 (GRCm39) unclassified probably benign
R5421:Sptbn5 UTSW 2 119,911,261 (GRCm39) critical splice donor site noncoding transcript
R5495:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5498:Sptbn5 UTSW 2 119,907,119 (GRCm39) unclassified probably benign
R5511:Sptbn5 UTSW 2 119,890,202 (GRCm39) unclassified probably benign
R5596:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5616:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5617:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5619:Sptbn5 UTSW 2 119,880,613 (GRCm39) exon noncoding transcript
R5625:Sptbn5 UTSW 2 119,910,273 (GRCm39) exon noncoding transcript
R5636:Sptbn5 UTSW 2 119,887,885 (GRCm39) unclassified probably benign
R5646:Sptbn5 UTSW 2 119,879,292 (GRCm39) splice site noncoding transcript
R5666:Sptbn5 UTSW 2 119,916,048 (GRCm39) unclassified probably benign
R5670:Sptbn5 UTSW 2 119,916,048 (GRCm39) unclassified probably benign
R5715:Sptbn5 UTSW 2 119,902,985 (GRCm39) missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 119,880,939 (GRCm39) exon noncoding transcript
R5885:Sptbn5 UTSW 2 119,907,144 (GRCm39) unclassified probably benign
R6016:Sptbn5 UTSW 2 119,880,573 (GRCm39) exon noncoding transcript
R6183:Sptbn5 UTSW 2 119,889,898 (GRCm39) unclassified probably benign
R6184:Sptbn5 UTSW 2 119,889,898 (GRCm39) unclassified probably benign
R6219:Sptbn5 UTSW 2 119,907,803 (GRCm39) unclassified probably benign
R6335:Sptbn5 UTSW 2 119,884,900 (GRCm39) unclassified probably benign
R6383:Sptbn5 UTSW 2 119,876,750 (GRCm39) unclassified probably benign
R6450:Sptbn5 UTSW 2 119,877,616 (GRCm39) unclassified probably benign
R6516:Sptbn5 UTSW 2 119,878,431 (GRCm39) unclassified probably benign
R6523:Sptbn5 UTSW 2 119,896,095 (GRCm39) splice site probably null
R6657:Sptbn5 UTSW 2 119,906,881 (GRCm39) unclassified probably benign
R6661:Sptbn5 UTSW 2 119,902,856 (GRCm39) missense possibly damaging 0.62
R8208:Sptbn5 UTSW 2 119,878,326 (GRCm39) nonsense noncoding transcript
R8261:Sptbn5 UTSW 2 119,877,616 (GRCm39) missense noncoding transcript
R8300:Sptbn5 UTSW 2 119,878,058 (GRCm39) missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- AACCCTAAAGGCCTGGTTCC -3'
(R):5'- TGGAGGAGTACACTGGTAACTG -3'

Sequencing Primer
(F):5'- GGTTCCCACCAACATAGGG -3'
(R):5'- TACACTGGTAACTGAATGAGTGG -3'
Posted On 2015-05-14