Mutagenetix > Incidental Mutations

Incidental Mutation 'R4119:Gpr37'

315222

Institutional Source

Beutler Lab

Gene Symbol

Gpr37

Ensembl Gene

ENSMUSG00000039904

Gene Name

G protein-coupled receptor 37

Synonyms

parkin-associated endothelin B-like receptor, Pael-R

MMRRC Submission

040992-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R4119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25665878-25690729 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25688426 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 224 (R224H)

Ref Sequence

ENSEMBL: ENSMUSP00000144683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054867
AA Change: R224H

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: R224H

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	101	116	N/A	INTRINSIC
Pfam:7tm_1	265	536	5.2e-33	PFAM
low complexity region	549	558	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200812
AA Change: R224H

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904
AA Change: R224H

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	101	116	N/A	INTRINSIC
Pfam:7tm_1	265	421	3.4e-26	PFAM

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	G	6: 124,356,904	L39P	probably damaging	Het
Abcc1	A	G	16: 14,394,013	M138V	probably benign	Het
Abl1	T	A	2: 31,801,727	I1067N	probably damaging	Het
Adam6a	C	T	12: 113,544,574	T189I	probably benign	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aplnr	T	C	2: 85,136,966	Y112H	possibly damaging	Het
Arhgap17	A	G	7: 123,306,994	F313S	probably damaging	Het
Arid1b	T	C	17: 4,995,794		probably benign	Het
Bcas1	G	C	2: 170,378,815	P394A	probably benign	Het
Ccdc116	A	G	16: 17,142,187	S213P	probably damaging	Het
Cdh15	T	C	8: 122,863,423	V365A	probably damaging	Het
Cenpf	A	G	1: 189,653,045	I2346T	probably benign	Het
Chd7	A	G	4: 8,785,658		probably benign	Het
Ezh2	A	C	6: 47,544,548	N390K	probably benign	Het
Fbxo7	C	A	10: 86,021,895		probably benign	Het
Fibin	A	G	2: 110,362,690	Y36H	probably damaging	Het
Gm597	A	T	1: 28,777,973	V326D	probably damaging	Het
Hars2	A	T	18: 36,790,488	N363I	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Itpr1	G	A	6: 108,394,355	D1140N	probably benign	Het
Lrig2	A	G	3: 104,467,195	V190A	probably benign	Het
Ltk	T	A	2: 119,757,948		probably benign	Het
Morc2a	C	A	11: 3,683,868	T660N	probably benign	Het
Msh3	A	G	13: 92,354,011		probably benign	Het
Myo15b	T	C	11: 115,873,492	S1311P	probably benign	Het
Nbeal1	A	T	1: 60,291,870	I2213L	probably damaging	Het
Olfr1122	T	A	2: 87,387,843	M46K	possibly damaging	Het
Olfr1155	A	G	2: 87,943,443	Y62H	probably damaging	Het
P2ry12	T	C	3: 59,217,841	T138A	probably benign	Het
Pirb	T	C	7: 3,717,575	D308G	probably damaging	Het
Pkn3	A	G	2: 30,083,037		probably benign	Het
Ripor1	T	A	8: 105,618,857		probably benign	Het
Ryr2	T	C	13: 11,779,267	T942A	probably benign	Het
Sptbn5	T	A	2: 120,064,529	D798V	possibly damaging	Het
Synpo2	T	A	3: 123,117,150	D282V	probably damaging	Het
Tnik	T	C	3: 28,666,175	F1287L	probably damaging	Het
Tshz1	T	G	18: 84,014,189	K698T	probably benign	Het
Ttc23l	A	C	15: 10,539,920	V159G	probably damaging	Het
Urb2	T	A	8: 124,047,240	D1503E	probably benign	Het
Usp29	T	A	7: 6,962,806	N549K	probably benign	Het
Vmn2r39	G	A	7: 9,023,674	H443Y	probably benign	Het
Zfp24	A	G	18: 24,014,569	Y229H	possibly damaging	Het
Zfp472	T	A	17: 32,978,215	Y421*	probably null	Het
Zkscan3	T	C	13: 21,393,949	E256G	possibly damaging	Het

Other mutations in Gpr37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Gpr37	APN	6	25669318	missense	possibly damaging	0.65
IGL01595:Gpr37	APN	6	25669573	missense	probably damaging	1.00
IGL01670:Gpr37	APN	6	25669834	missense	probably damaging	1.00
IGL02552:Gpr37	APN	6	25688687	missense	probably benign	0.05
IGL03331:Gpr37	APN	6	25669729	missense	probably benign	0.26
R0375:Gpr37	UTSW	6	25669291	missense	probably benign	0.08
R0534:Gpr37	UTSW	6	25669824	nonsense	probably null
R0892:Gpr37	UTSW	6	25688207	missense	probably damaging	1.00
R1481:Gpr37	UTSW	6	25669138	missense	probably damaging	0.99
R1700:Gpr37	UTSW	6	25669624	missense	probably benign	0.09
R2083:Gpr37	UTSW	6	25688417	missense	possibly damaging	0.62
R2089:Gpr37	UTSW	6	25689063	missense	possibly damaging	0.73
R2091:Gpr37	UTSW	6	25689063	missense	possibly damaging	0.73
R2091:Gpr37	UTSW	6	25689063	missense	possibly damaging	0.73
R2112:Gpr37	UTSW	6	25669381	missense	possibly damaging	0.91
R2847:Gpr37	UTSW	6	25666946	unclassified	probably benign
R2848:Gpr37	UTSW	6	25666946	unclassified	probably benign
R4611:Gpr37	UTSW	6	25669624	missense	probably benign	0.09
R4734:Gpr37	UTSW	6	25689086	missense	possibly damaging	0.53
R4765:Gpr37	UTSW	6	25669108	missense	probably damaging	1.00
R5163:Gpr37	UTSW	6	25669615	missense	possibly damaging	0.87
R5669:Gpr37	UTSW	6	25669352	missense	probably benign	0.05
R6548:Gpr37	UTSW	6	25688813	missense	probably benign	0.32
R6760:Gpr37	UTSW	6	25669169	missense	probably benign	0.00
R7030:Gpr37	UTSW	6	25689005	missense	possibly damaging	0.92
R7278:Gpr37	UTSW	6	25669342	missense	possibly damaging	0.68
R7392:Gpr37	UTSW	6	25688787	missense	probably benign	0.34
R7726:Gpr37	UTSW	6	25669117	missense	possibly damaging	0.94
R7754:Gpr37	UTSW	6	25689050	missense	probably damaging	0.99
R7757:Gpr37	UTSW	6	25688208	missense	probably benign	0.26
R8344:Gpr37	UTSW	6	25669531	missense	probably damaging	1.00
R8734:Gpr37	UTSW	6	25688202	missense	probably benign	0.17
R8839:Gpr37	UTSW	6	25669370	missense	probably benign	0.15
V7732:Gpr37	UTSW	6	25669123	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GATGCTCCTCATGTAGTAATTGTGAC -3'
(R):5'- AGAGATGAGTTCCAAGCGCG -3'

Sequencing Primer
(F):5'- GTAATTGTGACACACGATGCAC -3'
(R):5'- TTCCAAGCGCGATGGGATTC -3'

Posted On

2015-05-14