Incidental Mutation 'R4119:Ezh2'
ID315223
Institutional Source Beutler Lab
Gene Symbol Ezh2
Ensembl Gene ENSMUSG00000029687
Gene Nameenhancer of zeste 2 polycomb repressive complex 2 subunit
SynonymsEnx-1, KMT6, Enx1h
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47530139-47595341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47544548 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 390 (N390K)
Ref Sequence ENSEMBL: ENSMUSP00000110263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618] [ENSMUST00000169889] [ENSMUST00000204798]
Predicted Effect probably benign
Transcript: ENSMUST00000081721
AA Change: N429K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: N429K

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.1e-18 PFAM
SANT 159 250 9.7e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 555 592 1.05e-1 SMART
SET 612 733 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092648
AA Change: N429K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: N429K

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.9e-20 PFAM
SANT 159 250 9.7e-3 SMART
Blast:SET 272 333 3e-13 BLAST
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 513 550 1.05e-1 SMART
SET 570 691 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114616
AA Change: N390K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: N390K

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
SANT 120 211 9.7e-3 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 346 370 N/A INTRINSIC
SANT 389 437 6.62e-1 SMART
CXC 516 553 1.05e-1 SMART
SET 573 694 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114618
AA Change: N425K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: N425K

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 7.4e-20 PFAM
SANT 150 241 9.7e-3 SMART
low complexity region 345 362 N/A INTRINSIC
low complexity region 381 405 N/A INTRINSIC
SANT 424 472 6.62e-1 SMART
CXC 551 588 1.05e-1 SMART
SET 608 729 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164006
SMART Domains Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 96 1e-16 BLAST
low complexity region 98 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165492
Predicted Effect probably benign
Transcript: ENSMUST00000167278
SMART Domains Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169889
SMART Domains Protein: ENSMUSP00000126481
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Blast:SET 18 150 3e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181519
Predicted Effect probably benign
Transcript: ENSMUST00000204243
Predicted Effect probably benign
Transcript: ENSMUST00000204798
SMART Domains Protein: ENSMUSP00000144780
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.4e-16 PFAM
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Ezh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Ezh2 APN 6 47556055 nonsense probably null
IGL01932:Ezh2 APN 6 47532048 missense probably damaging 0.99
IGL02019:Ezh2 APN 6 47551901 splice site probably null
IGL02748:Ezh2 APN 6 47558239 missense probably damaging 1.00
IGL02749:Ezh2 APN 6 47533764 missense probably damaging 0.99
IGL03171:Ezh2 APN 6 47540781 nonsense probably null
Peezy UTSW 6 47533758 nonsense probably null
R0417:Ezh2 UTSW 6 47551726 missense probably benign 0.00
R1256:Ezh2 UTSW 6 47541855 nonsense probably null
R1587:Ezh2 UTSW 6 47552490 critical splice acceptor site probably null
R1631:Ezh2 UTSW 6 47577658 start codon destroyed probably null 0.01
R1736:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R1775:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R2076:Ezh2 UTSW 6 47576633 nonsense probably null
R2311:Ezh2 UTSW 6 47558260 missense probably damaging 1.00
R3751:Ezh2 UTSW 6 47556064 missense possibly damaging 0.94
R4016:Ezh2 UTSW 6 47544582 missense probably benign
R4214:Ezh2 UTSW 6 47533814 missense probably damaging 1.00
R4770:Ezh2 UTSW 6 47540696 missense probably damaging 1.00
R5133:Ezh2 UTSW 6 47540750 missense probably damaging 1.00
R5137:Ezh2 UTSW 6 47532080 splice site probably null
R5199:Ezh2 UTSW 6 47551725 missense probably benign 0.01
R5343:Ezh2 UTSW 6 47576615 missense probably damaging 1.00
R5584:Ezh2 UTSW 6 47532016 missense probably damaging 1.00
R5942:Ezh2 UTSW 6 47577582 missense possibly damaging 0.94
R6057:Ezh2 UTSW 6 47552423 missense probably damaging 1.00
R7247:Ezh2 UTSW 6 47533774 missense probably damaging 1.00
R7284:Ezh2 UTSW 6 47544519 missense probably benign 0.00
R7365:Ezh2 UTSW 6 47533758 nonsense probably null
R7382:Ezh2 UTSW 6 47551836 missense possibly damaging 0.55
R7718:Ezh2 UTSW 6 47554191 missense probably benign
R7910:Ezh2 UTSW 6 47556143 missense probably damaging 0.96
R8206:Ezh2 UTSW 6 47532900 critical splice donor site probably null
R8428:Ezh2 UTSW 6 47545811 nonsense probably null
R8746:Ezh2 UTSW 6 47576600 missense probably damaging 0.99
R8836:Ezh2 UTSW 6 47554262 missense probably benign
R8927:Ezh2 UTSW 6 47533779 missense not run
X0021:Ezh2 UTSW 6 47554169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTATGTCTGGATAATGAGCACATG -3'
(R):5'- CGTCTTTGCATATGTGTCAGTATAC -3'

Sequencing Primer
(F):5'- GGATAATGAGCACATGTTATTCCTG -3'
(R):5'- AACATCCTGAGTATGGGTCCTTAC -3'
Posted On2015-05-14