Mutagenetix > Incidental Mutations

Incidental Mutation 'R4119:Arhgap17'

315229

Institutional Source

Beutler Lab

Gene Symbol

Arhgap17

Ensembl Gene

ENSMUSG00000030766

Gene Name

Rho GTPase activating protein 17

Synonyms

Nadrin2, Nadrin, WBP15, 5730403H17Rik, Rich1

MMRRC Submission

040992-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4119 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

123279218-123369915 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123306994 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 313 (F313S)

Ref Sequence

ENSEMBL: ENSMUSP00000145628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000206117] [ENSMUST00000207010]

Predicted Effect

probably damaging
Transcript: ENSMUST00000098060
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766
AA Change: F313S

Domain	Start	End	E-Value	Type
BAR	1	239	4.45e-65	SMART
RhoGAP	263	439	1.2e-60	SMART
low complexity region	554	595	N/A	INTRINSIC
low complexity region	624	640	N/A	INTRINSIC
low complexity region	644	664	N/A	INTRINSIC
low complexity region	683	704	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106442
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766
AA Change: F313S

Domain	Start	End	E-Value	Type
BAR	1	239	4.45e-65	SMART
RhoGAP	263	439	1.2e-60	SMART
low complexity region	542	557	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC
low complexity region	632	673	N/A	INTRINSIC
low complexity region	702	718	N/A	INTRINSIC
low complexity region	722	742	N/A	INTRINSIC
low complexity region	761	782	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167309
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766
AA Change: F313S

Domain	Start	End	E-Value	Type
BAR	1	239	4.45e-65	SMART
RhoGAP	263	439	1.2e-60	SMART
low complexity region	542	557	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC
low complexity region	632	673	N/A	INTRINSIC
low complexity region	702	718	N/A	INTRINSIC
low complexity region	722	742	N/A	INTRINSIC
low complexity region	761	782	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000205262
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000206117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206294

Predicted Effect

probably damaging
Transcript: ENSMUST00000207010
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.3739

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	G	6: 124,356,904	L39P	probably damaging	Het
Abcc1	A	G	16: 14,394,013	M138V	probably benign	Het
Abl1	T	A	2: 31,801,727	I1067N	probably damaging	Het
Adam6a	C	T	12: 113,544,574	T189I	probably benign	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aplnr	T	C	2: 85,136,966	Y112H	possibly damaging	Het
Arid1b	T	C	17: 4,995,794		probably benign	Het
Bcas1	G	C	2: 170,378,815	P394A	probably benign	Het
Ccdc116	A	G	16: 17,142,187	S213P	probably damaging	Het
Cdh15	T	C	8: 122,863,423	V365A	probably damaging	Het
Cenpf	A	G	1: 189,653,045	I2346T	probably benign	Het
Chd7	A	G	4: 8,785,658		probably benign	Het
Ezh2	A	C	6: 47,544,548	N390K	probably benign	Het
Fbxo7	C	A	10: 86,021,895		probably benign	Het
Fibin	A	G	2: 110,362,690	Y36H	probably damaging	Het
Gm597	A	T	1: 28,777,973	V326D	probably damaging	Het
Gpr37	C	T	6: 25,688,426	R224H	possibly damaging	Het
Hars2	A	T	18: 36,790,488	N363I	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Itpr1	G	A	6: 108,394,355	D1140N	probably benign	Het
Lrig2	A	G	3: 104,467,195	V190A	probably benign	Het
Ltk	T	A	2: 119,757,948		probably benign	Het
Morc2a	C	A	11: 3,683,868	T660N	probably benign	Het
Msh3	A	G	13: 92,354,011		probably benign	Het
Myo15b	T	C	11: 115,873,492	S1311P	probably benign	Het
Nbeal1	A	T	1: 60,291,870	I2213L	probably damaging	Het
Olfr1122	T	A	2: 87,387,843	M46K	possibly damaging	Het
Olfr1155	A	G	2: 87,943,443	Y62H	probably damaging	Het
P2ry12	T	C	3: 59,217,841	T138A	probably benign	Het
Pirb	T	C	7: 3,717,575	D308G	probably damaging	Het
Pkn3	A	G	2: 30,083,037		probably benign	Het
Ripor1	T	A	8: 105,618,857		probably benign	Het
Ryr2	T	C	13: 11,779,267	T942A	probably benign	Het
Sptbn5	T	A	2: 120,064,529	D798V	possibly damaging	Het
Synpo2	T	A	3: 123,117,150	D282V	probably damaging	Het
Tnik	T	C	3: 28,666,175	F1287L	probably damaging	Het
Tshz1	T	G	18: 84,014,189	K698T	probably benign	Het
Ttc23l	A	C	15: 10,539,920	V159G	probably damaging	Het
Urb2	T	A	8: 124,047,240	D1503E	probably benign	Het
Usp29	T	A	7: 6,962,806	N549K	probably benign	Het
Vmn2r39	G	A	7: 9,023,674	H443Y	probably benign	Het
Zfp24	A	G	18: 24,014,569	Y229H	possibly damaging	Het
Zfp472	T	A	17: 32,978,215	Y421*	probably null	Het
Zkscan3	T	C	13: 21,393,949	E256G	possibly damaging	Het

Other mutations in Arhgap17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01012:Arhgap17	APN	7	123286568	utr 3 prime	probably benign
IGL02112:Arhgap17	APN	7	123318417	missense	possibly damaging	0.92
IGL02117:Arhgap17	APN	7	123286773	utr 3 prime	probably benign
IGL03062:Arhgap17	APN	7	123321874	splice site	probably null
gensing	UTSW	7	123314690	missense	probably damaging	1.00
Nightshade	UTSW	7	123327244	missense	probably damaging	1.00
tuberose	UTSW	7	123308377	missense	probably damaging	1.00
yam	UTSW	7	123306420	missense	probably damaging	1.00
P0028:Arhgap17	UTSW	7	123286677	utr 3 prime	probably benign
R0480:Arhgap17	UTSW	7	123294644	missense	probably damaging	0.98
R0593:Arhgap17	UTSW	7	123286743	utr 3 prime	probably benign
R0594:Arhgap17	UTSW	7	123294518	missense	probably benign	0.00
R0599:Arhgap17	UTSW	7	123303790	splice site	probably benign
R0751:Arhgap17	UTSW	7	123314690	missense	probably damaging	1.00
R1184:Arhgap17	UTSW	7	123314690	missense	probably damaging	1.00
R1791:Arhgap17	UTSW	7	123286702	missense	probably benign	0.23
R2036:Arhgap17	UTSW	7	123318494	missense	possibly damaging	0.92
R3428:Arhgap17	UTSW	7	123323631	missense	probably damaging	1.00
R4032:Arhgap17	UTSW	7	123280066	utr 3 prime	probably benign
R4652:Arhgap17	UTSW	7	123286618	utr 3 prime	probably benign
R4687:Arhgap17	UTSW	7	123321603	missense	probably damaging	1.00
R4910:Arhgap17	UTSW	7	123308377	missense	probably damaging	1.00
R4960:Arhgap17	UTSW	7	123286926	utr 3 prime	probably benign
R4963:Arhgap17	UTSW	7	123308360	missense	possibly damaging	0.91
R5028:Arhgap17	UTSW	7	123294673	missense	probably benign	0.05
R5253:Arhgap17	UTSW	7	123303748	missense	probably benign	0.00
R5316:Arhgap17	UTSW	7	123296527	missense	possibly damaging	0.63
R5410:Arhgap17	UTSW	7	123297493	critical splice donor site	probably null
R5890:Arhgap17	UTSW	7	123286758	utr 3 prime	probably benign
R6367:Arhgap17	UTSW	7	123308363	makesense	probably null
R6376:Arhgap17	UTSW	7	123300504	missense	probably damaging	1.00
R6513:Arhgap17	UTSW	7	123292156	missense	possibly damaging	0.87
R6862:Arhgap17	UTSW	7	123321901	missense	probably damaging	0.98
R6962:Arhgap17	UTSW	7	123296432	missense	probably damaging	1.00
R7077:Arhgap17	UTSW	7	123280008	missense	unknown
R7178:Arhgap17	UTSW	7	123285358	splice site	probably null
R7205:Arhgap17	UTSW	7	123306438	missense	probably damaging	1.00
R7342:Arhgap17	UTSW	7	123327244	missense	probably damaging	1.00
R7524:Arhgap17	UTSW	7	123306420	missense	probably damaging	1.00
R7812:Arhgap17	UTSW	7	123280067	missense	unknown
R7901:Arhgap17	UTSW	7	123286568	utr 3 prime	probably benign
R7950:Arhgap17	UTSW	7	123286816	missense	probably benign	0.23
R7952:Arhgap17	UTSW	7	123286691	missense	probably benign	0.23
R8842:Arhgap17	UTSW	7	123294527	missense	probably benign	0.07
RF009:Arhgap17	UTSW	7	123286862	small deletion	probably benign
RF015:Arhgap17	UTSW	7	123286862	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCATGCTAGCTTCACCTTTG -3'
(R):5'- ATGGGTAGTGTGGCTCTCAC -3'

Sequencing Primer
(F):5'- CACCTTTGCTTGTAACAAGGACTGG -3'
(R):5'- TGGCTCTCACAAGCAAGATG -3'

Posted On

2015-05-14