Incidental Mutation 'R4119:Arhgap17'
ID315229
Institutional Source Beutler Lab
Gene Symbol Arhgap17
Ensembl Gene ENSMUSG00000030766
Gene NameRho GTPase activating protein 17
SynonymsNadrin2, Nadrin, WBP15, 5730403H17Rik, Rich1
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score224
Status Validated
Chromosome7
Chromosomal Location123279218-123369915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123306994 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 313 (F313S)
Ref Sequence ENSEMBL: ENSMUSP00000145628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000206117] [ENSMUST00000207010]
Predicted Effect probably damaging
Transcript: ENSMUST00000098060
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766
AA Change: F313S

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106442
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766
AA Change: F313S

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167309
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766
AA Change: F313S

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205262
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206294
Predicted Effect probably damaging
Transcript: ENSMUST00000207010
AA Change: F313S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3739 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Arhgap17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Arhgap17 APN 7 123286568 utr 3 prime probably benign
IGL02112:Arhgap17 APN 7 123318417 missense possibly damaging 0.92
IGL02117:Arhgap17 APN 7 123286773 utr 3 prime probably benign
IGL03062:Arhgap17 APN 7 123321874 splice site probably null
gensing UTSW 7 123314690 missense probably damaging 1.00
Nightshade UTSW 7 123327244 missense probably damaging 1.00
tuberose UTSW 7 123308377 missense probably damaging 1.00
yam UTSW 7 123306420 missense probably damaging 1.00
P0028:Arhgap17 UTSW 7 123286677 utr 3 prime probably benign
R0480:Arhgap17 UTSW 7 123294644 missense probably damaging 0.98
R0593:Arhgap17 UTSW 7 123286743 utr 3 prime probably benign
R0594:Arhgap17 UTSW 7 123294518 missense probably benign 0.00
R0599:Arhgap17 UTSW 7 123303790 splice site probably benign
R0751:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1184:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1791:Arhgap17 UTSW 7 123286702 missense probably benign 0.23
R2036:Arhgap17 UTSW 7 123318494 missense possibly damaging 0.92
R3428:Arhgap17 UTSW 7 123323631 missense probably damaging 1.00
R4032:Arhgap17 UTSW 7 123280066 utr 3 prime probably benign
R4652:Arhgap17 UTSW 7 123286618 utr 3 prime probably benign
R4687:Arhgap17 UTSW 7 123321603 missense probably damaging 1.00
R4910:Arhgap17 UTSW 7 123308377 missense probably damaging 1.00
R4960:Arhgap17 UTSW 7 123286926 utr 3 prime probably benign
R4963:Arhgap17 UTSW 7 123308360 missense possibly damaging 0.91
R5028:Arhgap17 UTSW 7 123294673 missense probably benign 0.05
R5253:Arhgap17 UTSW 7 123303748 missense probably benign 0.00
R5316:Arhgap17 UTSW 7 123296527 missense possibly damaging 0.63
R5410:Arhgap17 UTSW 7 123297493 critical splice donor site probably null
R5890:Arhgap17 UTSW 7 123286758 utr 3 prime probably benign
R6367:Arhgap17 UTSW 7 123308363 makesense probably null
R6376:Arhgap17 UTSW 7 123300504 missense probably damaging 1.00
R6513:Arhgap17 UTSW 7 123292156 missense possibly damaging 0.87
R6862:Arhgap17 UTSW 7 123321901 missense probably damaging 0.98
R6962:Arhgap17 UTSW 7 123296432 missense probably damaging 1.00
R7077:Arhgap17 UTSW 7 123280008 missense unknown
R7178:Arhgap17 UTSW 7 123285358 splice site probably null
R7205:Arhgap17 UTSW 7 123306438 missense probably damaging 1.00
R7342:Arhgap17 UTSW 7 123327244 missense probably damaging 1.00
R7524:Arhgap17 UTSW 7 123306420 missense probably damaging 1.00
R7812:Arhgap17 UTSW 7 123280067 missense unknown
R7901:Arhgap17 UTSW 7 123286568 utr 3 prime probably benign
R7950:Arhgap17 UTSW 7 123286816 missense probably benign 0.23
R7952:Arhgap17 UTSW 7 123286691 missense probably benign 0.23
R8842:Arhgap17 UTSW 7 123294527 missense probably benign 0.07
RF009:Arhgap17 UTSW 7 123286862 small deletion probably benign
RF015:Arhgap17 UTSW 7 123286862 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATGCATGCTAGCTTCACCTTTG -3'
(R):5'- ATGGGTAGTGTGGCTCTCAC -3'

Sequencing Primer
(F):5'- CACCTTTGCTTGTAACAAGGACTGG -3'
(R):5'- TGGCTCTCACAAGCAAGATG -3'
Posted On2015-05-14