Incidental Mutation 'R4119:Ip6k2'
ID315234
Institutional Source Beutler Lab
Gene Symbol Ip6k2
Ensembl Gene ENSMUSG00000032599
Gene Nameinositol hexaphosphate kinase 2
SynonymsIhpk2, 1500005N04Rik
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108783796-108806337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108805648 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 319 (R319Q)
Ref Sequence ENSEMBL: ENSMUSP00000082091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000085018] [ENSMUST00000193560] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably benign
Transcript: ENSMUST00000035218
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085018
AA Change: R319Q

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: R319Q

DomainStartEndE-ValueType
Pfam:IPK 225 440 2.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193560
AA Change: R273Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: R273Q

DomainStartEndE-ValueType
Pfam:IPK 179 394 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Ip6k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ip6k2 APN 9 108805744 missense probably damaging 1.00
IGL01585:Ip6k2 APN 9 108796313 missense probably damaging 1.00
IGL02377:Ip6k2 APN 9 108804599 missense probably damaging 1.00
IGL02831:Ip6k2 APN 9 108804534 unclassified probably benign
banting UTSW 9 108805648 missense probably benign 0.07
R0310:Ip6k2 UTSW 9 108799233 splice site probably benign
R0541:Ip6k2 UTSW 9 108804627 missense probably damaging 1.00
R2378:Ip6k2 UTSW 9 108796301 splice site probably null
R4120:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4165:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4231:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4232:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4235:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4236:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4327:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4328:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R5019:Ip6k2 UTSW 9 108797746 intron probably benign
R5466:Ip6k2 UTSW 9 108798462 missense probably damaging 1.00
R6017:Ip6k2 UTSW 9 108797267 missense probably benign 0.01
R6688:Ip6k2 UTSW 9 108806011 missense probably benign 0.00
R6971:Ip6k2 UTSW 9 108797311 intron probably benign
R7150:Ip6k2 UTSW 9 108796731 missense unknown
R8007:Ip6k2 UTSW 9 108805756 missense probably benign 0.15
R8826:Ip6k2 UTSW 9 108798180 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGGACCTACTCAACAGCC -3'
(R):5'- AGACTCATCAGCCGACTCTTC -3'

Sequencing Primer
(F):5'- ATCGCCTGTGTTCACCCAATG -3'
(R):5'- GATGACCAGTAGGGAACT -3'
Posted On2015-05-14