Incidental Mutation 'R4119:Fbxo7'
ID 315235
Institutional Source Beutler Lab
Gene Symbol Fbxo7
Ensembl Gene ENSMUSG00000001786
Gene Name F-box protein 7
Synonyms 2410015K21Rik, A230052G17Rik
MMRRC Submission 040992-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4119 (G1)
Quality Score 210
Status Validated
Chromosome 10
Chromosomal Location 85857836-85887737 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 85857759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001837] [ENSMUST00000117597] [ENSMUST00000120344] [ENSMUST00000130320] [ENSMUST00000147168]
AlphaFold Q3U7U3
Predicted Effect probably benign
Transcript: ENSMUST00000001837
SMART Domains Protein: ENSMUSP00000001837
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Blast:UBQ 1 40 7e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117597
SMART Domains Protein: ENSMUSP00000113263
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 101 245 9.6e-31 PFAM
Pfam:F-box 250 297 2.7e-6 PFAM
Pfam:F-box-like 252 298 7.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120344
SMART Domains Protein: ENSMUSP00000113222
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 103 247 4.8e-31 PFAM
Pfam:F-box 252 299 1.8e-6 PFAM
Pfam:F-box-like 254 300 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130320
SMART Domains Protein: ENSMUSP00000120840
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 78 7e-6 SMART
Blast:UBQ 1 79 6e-30 BLAST
Pfam:PI31_Prot_N 188 323 4.7e-20 PFAM
Pfam:F-box 331 378 9.7e-6 PFAM
Pfam:F-box-like 333 379 9.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181665
SMART Domains Protein: ENSMUSP00000137845
Gene: ENSMUSG00000097692

DomainStartEndE-ValueType
low complexity region 77 90 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190739
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pro-B cell numbers and increased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,333,863 (GRCm39) L39P probably damaging Het
Abcc1 A G 16: 14,211,877 (GRCm39) M138V probably benign Het
Abl1 T A 2: 31,691,739 (GRCm39) I1067N probably damaging Het
Adam6a C T 12: 113,508,194 (GRCm39) T189I probably benign Het
Ankfy1 G A 11: 72,605,310 (GRCm39) probably null Het
Aplnr T C 2: 84,967,310 (GRCm39) Y112H possibly damaging Het
Arhgap17 A G 7: 122,906,217 (GRCm39) F313S probably damaging Het
Arid1b T C 17: 5,046,069 (GRCm39) probably benign Het
Bcas1 G C 2: 170,220,735 (GRCm39) P394A probably benign Het
Ccdc116 A G 16: 16,960,051 (GRCm39) S213P probably damaging Het
Cdh15 T C 8: 123,590,162 (GRCm39) V365A probably damaging Het
Cenpf A G 1: 189,385,242 (GRCm39) I2346T probably benign Het
Chd7 A G 4: 8,785,658 (GRCm39) probably benign Het
Ezh2 A C 6: 47,521,482 (GRCm39) N390K probably benign Het
Fibin A G 2: 110,193,035 (GRCm39) Y36H probably damaging Het
Gpr37 C T 6: 25,688,425 (GRCm39) R224H possibly damaging Het
Hars2 A T 18: 36,923,541 (GRCm39) N363I probably damaging Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Itpr1 G A 6: 108,371,316 (GRCm39) D1140N probably benign Het
Lrig2 A G 3: 104,374,511 (GRCm39) V190A probably benign Het
Ltk T A 2: 119,588,429 (GRCm39) probably benign Het
Morc2a C A 11: 3,633,868 (GRCm39) T660N probably benign Het
Msh3 A G 13: 92,490,519 (GRCm39) probably benign Het
Myo15b T C 11: 115,764,318 (GRCm39) S1311P probably benign Het
Nbeal1 A T 1: 60,331,029 (GRCm39) I2213L probably damaging Het
Or10ag57 T A 2: 87,218,187 (GRCm39) M46K possibly damaging Het
Or5d16 A G 2: 87,773,787 (GRCm39) Y62H probably damaging Het
P2ry12 T C 3: 59,125,262 (GRCm39) T138A probably benign Het
Pirb T C 7: 3,720,574 (GRCm39) D308G probably damaging Het
Pkn3 A G 2: 29,973,049 (GRCm39) probably benign Het
Ripor1 T A 8: 106,345,489 (GRCm39) probably benign Het
Ryr2 T C 13: 11,794,153 (GRCm39) T942A probably benign Het
Spata31e5 A T 1: 28,817,054 (GRCm39) V326D probably damaging Het
Sptbn5 T A 2: 119,895,010 (GRCm39) D798V possibly damaging Het
Synpo2 T A 3: 122,910,799 (GRCm39) D282V probably damaging Het
Tnik T C 3: 28,720,324 (GRCm39) F1287L probably damaging Het
Tshz1 T G 18: 84,032,314 (GRCm39) K698T probably benign Het
Ttc23l A C 15: 10,540,006 (GRCm39) V159G probably damaging Het
Urb2 T A 8: 124,773,979 (GRCm39) D1503E probably benign Het
Usp29 T A 7: 6,965,805 (GRCm39) N549K probably benign Het
Vmn2r39 G A 7: 9,026,673 (GRCm39) H443Y probably benign Het
Zfp24 A G 18: 24,147,626 (GRCm39) Y229H possibly damaging Het
Zfp472 T A 17: 33,197,189 (GRCm39) Y421* probably null Het
Zkscan3 T C 13: 21,578,119 (GRCm39) E256G possibly damaging Het
Other mutations in Fbxo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Fbxo7 APN 10 85,864,928 (GRCm39) missense probably damaging 0.98
IGL01483:Fbxo7 APN 10 85,880,445 (GRCm39) missense probably damaging 1.00
IGL02502:Fbxo7 APN 10 85,869,161 (GRCm39) missense probably damaging 1.00
IGL02712:Fbxo7 APN 10 85,860,302 (GRCm39) missense possibly damaging 0.75
P0007:Fbxo7 UTSW 10 85,869,157 (GRCm39) missense possibly damaging 0.95
R0410:Fbxo7 UTSW 10 85,865,102 (GRCm39) critical splice donor site probably null
R4604:Fbxo7 UTSW 10 85,882,666 (GRCm39) missense probably damaging 1.00
R4884:Fbxo7 UTSW 10 85,865,014 (GRCm39) missense probably damaging 0.99
R5088:Fbxo7 UTSW 10 85,857,784 (GRCm39) unclassified probably benign
R5286:Fbxo7 UTSW 10 85,857,954 (GRCm39) missense probably damaging 1.00
R5387:Fbxo7 UTSW 10 85,860,518 (GRCm39) missense probably benign 0.01
R5451:Fbxo7 UTSW 10 85,864,901 (GRCm39) missense probably benign 0.01
R5491:Fbxo7 UTSW 10 85,883,890 (GRCm39) missense probably damaging 1.00
R5542:Fbxo7 UTSW 10 85,869,149 (GRCm39) missense probably benign 0.00
R5647:Fbxo7 UTSW 10 85,864,974 (GRCm39) missense probably damaging 0.98
R6027:Fbxo7 UTSW 10 85,883,950 (GRCm39) missense probably damaging 1.00
R6152:Fbxo7 UTSW 10 85,860,560 (GRCm39) missense probably benign 0.01
R6280:Fbxo7 UTSW 10 85,864,969 (GRCm39) missense probably benign 0.00
R6615:Fbxo7 UTSW 10 85,880,398 (GRCm39) missense possibly damaging 0.48
R7405:Fbxo7 UTSW 10 85,880,445 (GRCm39) missense probably damaging 1.00
R8785:Fbxo7 UTSW 10 85,860,410 (GRCm39) missense probably benign 0.02
R9743:Fbxo7 UTSW 10 85,883,773 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGATCCTGCTTGCTGGGAG -3'
(R):5'- GAAACCCCGGAAGTGACTAC -3'

Sequencing Primer
(F):5'- GGGAAGGAACAAACTCGCTCAC -3'
(R):5'- AGCGTCACAGTCACAGGC -3'
Posted On 2015-05-14