Incidental Mutation 'R4119:Adam6a'
ID315239
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Namea disintegrin and metallopeptidase domain 6A
SynonymsAdam6
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113543908-113546465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113544574 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 189 (T189I)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
Predicted Effect probably benign
Transcript: ENSMUST00000053086
AA Change: T189I

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: T189I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8356:Adam6a UTSW 12 113546137 missense probably benign 0.08
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCAATCCATGGTCACTGTG -3'
(R):5'- CGCATATGAAGATTGGTCAGATAGG -3'

Sequencing Primer
(F):5'- GCAATCCATGGTCACTGTGGATAC -3'
(R):5'- TGGTCAGATAGGTGTCCATTAAAC -3'
Posted On2015-05-14