Incidental Mutation 'R4119:Ccdc116'
ID315244
Institutional Source Beutler Lab
Gene Symbol Ccdc116
Ensembl Gene ENSMUSG00000022768
Gene Namecoiled-coil domain containing 116
Synonyms
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17139064-17147229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17142187 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 213 (S213P)
Ref Sequence ENSEMBL: ENSMUSP00000156301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023452] [ENSMUST00000069064] [ENSMUST00000115709] [ENSMUST00000115711] [ENSMUST00000231493] [ENSMUST00000232033] [ENSMUST00000232540] [ENSMUST00000232479] [ENSMUST00000231597] [ENSMUST00000231708] [ENSMUST00000231726] [ENSMUST00000232344]
Predicted Effect probably benign
Transcript: ENSMUST00000023452
AA Change: S213P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023452
Gene: ENSMUSG00000022768
AA Change: S213P

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069064
SMART Domains Protein: ENSMUSP00000069864
Gene: ENSMUSG00000041774

DomainStartEndE-ValueType
Pfam:YdjC 7 288 1.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115709
AA Change: S213P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111374
Gene: ENSMUSG00000022768
AA Change: S213P

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115711
AA Change: S213P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111376
Gene: ENSMUSG00000022768
AA Change: S213P

DomainStartEndE-ValueType
Pfam:DUF4702 18 411 6.3e-223 PFAM
low complexity region 488 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145792
Predicted Effect probably benign
Transcript: ENSMUST00000231493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231539
Predicted Effect probably benign
Transcript: ENSMUST00000232033
AA Change: S213P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232540
AA Change: S213P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000232479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231975
Predicted Effect probably benign
Transcript: ENSMUST00000231597
Predicted Effect probably benign
Transcript: ENSMUST00000231708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231970
Predicted Effect probably benign
Transcript: ENSMUST00000231726
Predicted Effect probably benign
Transcript: ENSMUST00000232344
Meta Mutation Damage Score 0.1420 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Hars2 A T 18: 36,790,488 N363I probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Ccdc116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ccdc116 APN 16 17141992 missense probably damaging 1.00
IGL01905:Ccdc116 APN 16 17142561 missense probably damaging 0.99
IGL02751:Ccdc116 APN 16 17141972 missense probably benign 0.00
IGL03183:Ccdc116 APN 16 17142854 missense probably benign 0.07
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0122:Ccdc116 UTSW 16 17142734 missense probably damaging 1.00
R0219:Ccdc116 UTSW 16 17141612 missense possibly damaging 0.93
R1664:Ccdc116 UTSW 16 17142628 missense probably benign 0.02
R1718:Ccdc116 UTSW 16 17141908 missense probably benign
R2921:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2922:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2923:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R4223:Ccdc116 UTSW 16 17146945 unclassified probably benign
R5000:Ccdc116 UTSW 16 17141793 missense possibly damaging 0.95
R5293:Ccdc116 UTSW 16 17141787 missense possibly damaging 0.92
R5435:Ccdc116 UTSW 16 17142762 missense probably benign 0.38
R6694:Ccdc116 UTSW 16 17142791 missense probably benign 0.44
R7215:Ccdc116 UTSW 16 17139928 missense probably damaging 1.00
R7247:Ccdc116 UTSW 16 17139691 missense possibly damaging 0.89
R7771:Ccdc116 UTSW 16 17139591 missense probably benign 0.00
Z1088:Ccdc116 UTSW 16 17147171 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAGTGACTTCATCTCCTTG -3'
(R):5'- GAGGGACAAACTCCTGCTTGAG -3'

Sequencing Primer
(F):5'- GCAGTGACTTCATCTCCTTGTTTAAC -3'
(R):5'- GGGACAAACTCCTGCTTGAGAAAAAC -3'
Posted On2015-05-14