Incidental Mutation 'R4119:Hars2'
ID315248
Institutional Source Beutler Lab
Gene Symbol Hars2
Ensembl Gene ENSMUSG00000019143
Gene Namehistidyl-tRNA synthetase 2
SynonymsHarsl, HARSR, HO3
MMRRC Submission 040992-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4119 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36783008-36792562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36790488 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 363 (N363I)
Ref Sequence ENSEMBL: ENSMUSP00000019287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001419] [ENSMUST00000019287] [ENSMUST00000152954]
Predicted Effect probably benign
Transcript: ENSMUST00000001419
SMART Domains Protein: ENSMUSP00000001419
Gene: ENSMUSG00000001383

DomainStartEndE-ValueType
ZnF_U1 77 111 2.41e-11 SMART
ZnF_C2H2 80 104 5.48e0 SMART
coiled coil region 118 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000019287
AA Change: N363I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143
AA Change: N363I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 313 1.3e-23 PFAM
Pfam:tRNA-synt_2b 72 234 2.8e-21 PFAM
Pfam:HGTP_anticodon2 324 424 2.7e-8 PFAM
Pfam:HGTP_anticodon 329 420 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145876
Predicted Effect probably benign
Transcript: ENSMUST00000152954
AA Change: N444I

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143
AA Change: N444I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 389 1e-38 PFAM
Pfam:HGTP_anticodon 410 501 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155842
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of histidine to tRNA molecules. Mutations in a similar gene in human have been associated with Perrault syndrome 2 (PRLTS2). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,904 L39P probably damaging Het
Abcc1 A G 16: 14,394,013 M138V probably benign Het
Abl1 T A 2: 31,801,727 I1067N probably damaging Het
Adam6a C T 12: 113,544,574 T189I probably benign Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aplnr T C 2: 85,136,966 Y112H possibly damaging Het
Arhgap17 A G 7: 123,306,994 F313S probably damaging Het
Arid1b T C 17: 4,995,794 probably benign Het
Bcas1 G C 2: 170,378,815 P394A probably benign Het
Ccdc116 A G 16: 17,142,187 S213P probably damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Cenpf A G 1: 189,653,045 I2346T probably benign Het
Chd7 A G 4: 8,785,658 probably benign Het
Ezh2 A C 6: 47,544,548 N390K probably benign Het
Fbxo7 C A 10: 86,021,895 probably benign Het
Fibin A G 2: 110,362,690 Y36H probably damaging Het
Gm597 A T 1: 28,777,973 V326D probably damaging Het
Gpr37 C T 6: 25,688,426 R224H possibly damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Itpr1 G A 6: 108,394,355 D1140N probably benign Het
Lrig2 A G 3: 104,467,195 V190A probably benign Het
Ltk T A 2: 119,757,948 probably benign Het
Morc2a C A 11: 3,683,868 T660N probably benign Het
Msh3 A G 13: 92,354,011 probably benign Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Olfr1122 T A 2: 87,387,843 M46K possibly damaging Het
Olfr1155 A G 2: 87,943,443 Y62H probably damaging Het
P2ry12 T C 3: 59,217,841 T138A probably benign Het
Pirb T C 7: 3,717,575 D308G probably damaging Het
Pkn3 A G 2: 30,083,037 probably benign Het
Ripor1 T A 8: 105,618,857 probably benign Het
Ryr2 T C 13: 11,779,267 T942A probably benign Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Synpo2 T A 3: 123,117,150 D282V probably damaging Het
Tnik T C 3: 28,666,175 F1287L probably damaging Het
Tshz1 T G 18: 84,014,189 K698T probably benign Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Urb2 T A 8: 124,047,240 D1503E probably benign Het
Usp29 T A 7: 6,962,806 N549K probably benign Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Zfp24 A G 18: 24,014,569 Y229H possibly damaging Het
Zfp472 T A 17: 32,978,215 Y421* probably null Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Hars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Hars2 APN 18 36785936 missense probably damaging 1.00
IGL00955:Hars2 APN 18 36789357 splice site probably benign
IGL01570:Hars2 APN 18 36787592 missense probably benign 0.04
IGL01618:Hars2 APN 18 36789577 nonsense probably null
IGL02165:Hars2 APN 18 36783394 start codon destroyed probably null 1.00
IGL02290:Hars2 APN 18 36785626 missense possibly damaging 0.56
IGL02685:Hars2 APN 18 36791118 missense probably benign 0.18
IGL02805:Hars2 APN 18 36787577 nonsense probably null
IGL02971:Hars2 APN 18 36786178 missense probably damaging 1.00
IGL03373:Hars2 APN 18 36785945 missense probably damaging 0.99
R0196:Hars2 UTSW 18 36789204 nonsense probably null
R0543:Hars2 UTSW 18 36789424 missense probably damaging 1.00
R0549:Hars2 UTSW 18 36786208 critical splice donor site probably null
R0557:Hars2 UTSW 18 36791077 missense possibly damaging 0.94
R0893:Hars2 UTSW 18 36787595 missense possibly damaging 0.56
R1188:Hars2 UTSW 18 36787969 missense probably damaging 0.99
R1289:Hars2 UTSW 18 36783412 splice site probably null
R1381:Hars2 UTSW 18 36789217 missense possibly damaging 0.68
R2401:Hars2 UTSW 18 36789523 missense possibly damaging 0.95
R4351:Hars2 UTSW 18 36786178 missense probably damaging 1.00
R4404:Hars2 UTSW 18 36785936 missense probably damaging 1.00
R5372:Hars2 UTSW 18 36790481 missense possibly damaging 0.93
R5629:Hars2 UTSW 18 36788666 nonsense probably null
R5886:Hars2 UTSW 18 36790097 intron probably benign
R7069:Hars2 UTSW 18 36787956 missense probably damaging 0.99
R7070:Hars2 UTSW 18 36791112 nonsense probably null
R7188:Hars2 UTSW 18 36790561 missense probably benign 0.08
R7683:Hars2 UTSW 18 36788236 missense probably damaging 1.00
R7834:Hars2 UTSW 18 36789581 missense probably damaging 0.98
R7903:Hars2 UTSW 18 36786192 missense probably damaging 1.00
R8249:Hars2 UTSW 18 36788001 missense probably damaging 0.99
R8329:Hars2 UTSW 18 36789235 missense possibly damaging 0.94
R8362:Hars2 UTSW 18 36790175 missense probably benign
RF015:Hars2 UTSW 18 36785945 missense probably damaging 0.99
Z1177:Hars2 UTSW 18 36789575 missense probably damaging 1.00
Z1177:Hars2 UTSW 18 36790598 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ATCTGGGTGTATGTCGGCAC -3'
(R):5'- TGATACTAGTGTCTTAGCCAGTTC -3'

Sequencing Primer
(F):5'- ATGTCGGCACAGTGATCG -3'
(R):5'- GGCATGACAATATATGCCTGTTGCC -3'
Posted On2015-05-14