Incidental Mutation 'R4120:Asnsd1'
ID315251
Institutional Source Beutler Lab
Gene Symbol Asnsd1
Ensembl Gene ENSMUSG00000026095
Gene Nameasparagine synthetase domain containing 1
Synonyms2210409M21Rik
MMRRC Submission 040993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4120 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53344617-53352752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53347995 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000139404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027264] [ENSMUST00000123519] [ENSMUST00000144660] [ENSMUST00000147021] [ENSMUST00000154402]
Predicted Effect probably damaging
Transcript: ENSMUST00000027264
AA Change: S158P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027264
Gene: ENSMUSG00000026095
AA Change: S158P

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 2.4e-8 PFAM
Pfam:Asn_synthase 305 388 6.9e-7 PFAM
Pfam:Asn_synthase 505 619 2.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123519
SMART Domains Protein: ENSMUSP00000139025
Gene: ENSMUSG00000026095

DomainStartEndE-ValueType
Pfam:Asn_synthase 2 120 4.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136468
Predicted Effect probably damaging
Transcript: ENSMUST00000144660
AA Change: S158P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913
AA Change: S158P

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147021
Predicted Effect probably benign
Transcript: ENSMUST00000154402
Meta Mutation Damage Score 0.8098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C A 1: 25,094,307 E1233* probably null Het
Afap1l1 T C 18: 61,739,172 D526G probably damaging Het
Ago4 A G 4: 126,496,807 Y807H probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap40 A G 2: 158,532,330 M222V probably benign Het
C130026I21Rik C T 1: 85,259,821 V81M possibly damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Col4a1 G A 8: 11,206,263 P1535S unknown Het
Dennd2a G A 6: 39,465,096 R947C probably damaging Het
Dlg2 G A 7: 91,965,638 V217I probably damaging Het
Dnaaf2 T C 12: 69,198,038 D83G possibly damaging Het
Dppa5a A T 9: 78,367,855 M55K possibly damaging Het
Ect2l A G 10: 18,130,718 V779A probably benign Het
Ehhadh A G 16: 21,763,184 S353P probably benign Het
Etv3 A G 3: 87,536,282 D391G probably benign Het
Fastkd1 T A 2: 69,707,310 K309N probably damaging Het
Fip1l1 T A 5: 74,588,191 Y375N probably damaging Het
Flvcr2 T C 12: 85,786,129 S308P probably benign Het
Fyco1 T C 9: 123,825,626 Y1065C probably benign Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Gm17175 A T 14: 51,573,077 I31N probably damaging Het
Gm6003 T A 7: 33,165,551 noncoding transcript Het
Gm9951 T C 8: 34,055,839 noncoding transcript Het
Hspa2 A G 12: 76,405,234 E234G probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Iqsec1 A T 6: 90,662,602 Y1065* probably null Het
Ltk T A 2: 119,757,948 probably benign Het
Map2 G A 1: 66,415,904 A1318T probably damaging Het
Mas1 A T 17: 12,842,346 N63K probably damaging Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nav3 A G 10: 109,903,744 probably null Het
Nlrp1c-ps T C 11: 71,242,533 noncoding transcript Het
Oca2 A T 7: 56,254,882 D32V probably damaging Het
Olfr624 T C 7: 103,671,014 T6A probably benign Het
Olfr877 T C 9: 37,855,409 L197S possibly damaging Het
Otub2 T C 12: 103,404,230 V257A probably damaging Het
Pink1 G A 4: 138,315,511 R461* probably null Het
Plxna2 T C 1: 194,780,627 C901R probably damaging Het
Ptchd3 T A 11: 121,830,746 N148K probably damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Ripor1 T A 8: 105,618,857 probably benign Het
Sec13 T C 6: 113,734,676 N107S probably damaging Het
Slc12a2 A G 18: 57,899,355 M376V possibly damaging Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Stradb T A 1: 58,980,009 Y30N possibly damaging Het
Syne1 T A 10: 5,409,798 Q328L probably damaging Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Vmn2r100 T C 17: 19,531,953 S753P probably damaging Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Vmn2r-ps159 G T 4: 156,334,483 noncoding transcript Het
Zfp936 A G 7: 43,190,206 T366A probably benign Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Asnsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Asnsd1 APN 1 53346628 missense probably damaging 1.00
IGL00595:Asnsd1 APN 1 53347488 missense probably damaging 1.00
IGL00705:Asnsd1 APN 1 53348451 missense probably damaging 1.00
IGL01089:Asnsd1 APN 1 53348277 missense probably damaging 1.00
IGL01747:Asnsd1 APN 1 53348095 nonsense probably null
IGL02274:Asnsd1 APN 1 53347575 missense probably benign
R2021:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2022:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2126:Asnsd1 UTSW 1 53347317 missense probably benign 0.00
R2174:Asnsd1 UTSW 1 53347601 missense probably benign 0.44
R4435:Asnsd1 UTSW 1 53348073 splice site probably null
R4464:Asnsd1 UTSW 1 53352527 splice site probably null
R4499:Asnsd1 UTSW 1 53347970 missense probably benign
R4622:Asnsd1 UTSW 1 53348219 missense probably benign 0.13
R5090:Asnsd1 UTSW 1 53352404 unclassified probably benign
R5832:Asnsd1 UTSW 1 53347475 missense probably damaging 1.00
R5891:Asnsd1 UTSW 1 53347977 missense probably benign 0.00
R6215:Asnsd1 UTSW 1 53348028 splice site probably null
R6217:Asnsd1 UTSW 1 53348028 missense probably benign 0.02
R6353:Asnsd1 UTSW 1 53347779 missense probably benign
R6405:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R6913:Asnsd1 UTSW 1 53348231 missense probably damaging 0.99
R7217:Asnsd1 UTSW 1 53348193 missense probably damaging 1.00
R7570:Asnsd1 UTSW 1 53348258 missense probably damaging 1.00
R7589:Asnsd1 UTSW 1 53347967 missense probably benign 0.00
R7716:Asnsd1 UTSW 1 53347743 missense probably benign 0.05
R8314:Asnsd1 UTSW 1 53346655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCCTGCTGGAGTCTGAGTC -3'
(R):5'- GATAATGACACCCAGGTTATGTTC -3'

Sequencing Primer
(F):5'- CTGGAGTCTGAGTCAGGTCATTAC -3'
(R):5'- GACACCCAGGTTATGTTCAATAGC -3'
Posted On2015-05-14