Incidental Mutation 'R4120:Olfr624'
ID315274
Institutional Source Beutler Lab
Gene Symbol Olfr624
Ensembl Gene ENSMUSG00000045780
Gene Nameolfactory receptor 624
SynonymsMOR4-2P, GA_x6K02T2PBJ9-6394126-6393197
MMRRC Submission 040993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4120 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103665461-103671191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103671014 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144]
Predicted Effect probably benign
Transcript: ENSMUST00000062144
AA Change: T6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780
AA Change: T6A

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C A 1: 25,094,307 E1233* probably null Het
Afap1l1 T C 18: 61,739,172 D526G probably damaging Het
Ago4 A G 4: 126,496,807 Y807H probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap40 A G 2: 158,532,330 M222V probably benign Het
Asnsd1 A G 1: 53,347,995 S158P probably damaging Het
C130026I21Rik C T 1: 85,259,821 V81M possibly damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Col4a1 G A 8: 11,206,263 P1535S unknown Het
Dennd2a G A 6: 39,465,096 R947C probably damaging Het
Dlg2 G A 7: 91,965,638 V217I probably damaging Het
Dnaaf2 T C 12: 69,198,038 D83G possibly damaging Het
Dppa5a A T 9: 78,367,855 M55K possibly damaging Het
Ect2l A G 10: 18,130,718 V779A probably benign Het
Ehhadh A G 16: 21,763,184 S353P probably benign Het
Etv3 A G 3: 87,536,282 D391G probably benign Het
Fastkd1 T A 2: 69,707,310 K309N probably damaging Het
Fip1l1 T A 5: 74,588,191 Y375N probably damaging Het
Flvcr2 T C 12: 85,786,129 S308P probably benign Het
Fyco1 T C 9: 123,825,626 Y1065C probably benign Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Gm17175 A T 14: 51,573,077 I31N probably damaging Het
Gm6003 T A 7: 33,165,551 noncoding transcript Het
Gm9951 T C 8: 34,055,839 noncoding transcript Het
Hspa2 A G 12: 76,405,234 E234G probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Iqsec1 A T 6: 90,662,602 Y1065* probably null Het
Ltk T A 2: 119,757,948 probably benign Het
Map2 G A 1: 66,415,904 A1318T probably damaging Het
Mas1 A T 17: 12,842,346 N63K probably damaging Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nav3 A G 10: 109,903,744 probably null Het
Nlrp1c-ps T C 11: 71,242,533 noncoding transcript Het
Oca2 A T 7: 56,254,882 D32V probably damaging Het
Olfr877 T C 9: 37,855,409 L197S possibly damaging Het
Otub2 T C 12: 103,404,230 V257A probably damaging Het
Pink1 G A 4: 138,315,511 R461* probably null Het
Plxna2 T C 1: 194,780,627 C901R probably damaging Het
Ptchd3 T A 11: 121,830,746 N148K probably damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Ripor1 T A 8: 105,618,857 probably benign Het
Sec13 T C 6: 113,734,676 N107S probably damaging Het
Slc12a2 A G 18: 57,899,355 M376V possibly damaging Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Stradb T A 1: 58,980,009 Y30N possibly damaging Het
Syne1 T A 10: 5,409,798 Q328L probably damaging Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Vmn2r100 T C 17: 19,531,953 S753P probably damaging Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Vmn2r-ps159 G T 4: 156,334,483 noncoding transcript Het
Zfp936 A G 7: 43,190,206 T366A probably benign Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Olfr624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr624 APN 7 103670475 nonsense probably null
IGL02536:Olfr624 APN 7 103670957 missense possibly damaging 0.78
IGL02684:Olfr624 APN 7 103670384 missense probably benign 0.06
FR4548:Olfr624 UTSW 7 103670967 nonsense probably null
FR4548:Olfr624 UTSW 7 103670960 small insertion probably benign
FR4976:Olfr624 UTSW 7 103670966 small insertion probably benign
R0295:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R0518:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R0521:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R1352:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R1779:Olfr624 UTSW 7 103670638 missense probably benign 0.15
R1878:Olfr624 UTSW 7 103670182 missense probably damaging 1.00
R1965:Olfr624 UTSW 7 103670896 missense probably damaging 1.00
R2162:Olfr624 UTSW 7 103670872 missense possibly damaging 0.95
R2316:Olfr624 UTSW 7 103670467 missense probably damaging 0.97
R3792:Olfr624 UTSW 7 103670146 missense probably damaging 1.00
R3848:Olfr624 UTSW 7 103670701 missense probably damaging 0.99
R4183:Olfr624 UTSW 7 103670971 missense possibly damaging 0.87
R4853:Olfr624 UTSW 7 103670803 missense probably damaging 1.00
R6351:Olfr624 UTSW 7 103670956 missense possibly damaging 0.50
R7717:Olfr624 UTSW 7 103670945 missense probably benign
RF005:Olfr624 UTSW 7 103670785 frame shift probably null
X0026:Olfr624 UTSW 7 103670395 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCGTGTGCACAGTAGACAG -3'
(R):5'- GCATAGGTTTCTGCAATGATGTAC -3'

Sequencing Primer
(F):5'- CCCATGCATAGGTCTGTGAG -3'
(R):5'- TCTGCAATGATGTACAACCAAGG -3'
Posted On2015-05-14