Incidental Mutation 'R4120:Fyco1'
ID315282
Institutional Source Beutler Lab
Gene Symbol Fyco1
Ensembl Gene ENSMUSG00000025241
Gene NameFYVE and coiled-coil domain containing 1
SynonymsMem2, ZFYVE7, 2810409M01Rik
MMRRC Submission 040993-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4120 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123789500-123851899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123825626 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1065 (Y1065C)
Ref Sequence ENSEMBL: ENSMUSP00000133222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000184082]
Predicted Effect probably benign
Transcript: ENSMUST00000084715
AA Change: Y1065C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241
AA Change: Y1065C

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
AA Change: Y1065C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241
AA Change: Y1065C

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184082
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C A 1: 25,094,307 E1233* probably null Het
Afap1l1 T C 18: 61,739,172 D526G probably damaging Het
Ago4 A G 4: 126,496,807 Y807H probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap40 A G 2: 158,532,330 M222V probably benign Het
Asnsd1 A G 1: 53,347,995 S158P probably damaging Het
C130026I21Rik C T 1: 85,259,821 V81M possibly damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Col4a1 G A 8: 11,206,263 P1535S unknown Het
Dennd2a G A 6: 39,465,096 R947C probably damaging Het
Dlg2 G A 7: 91,965,638 V217I probably damaging Het
Dnaaf2 T C 12: 69,198,038 D83G possibly damaging Het
Dppa5a A T 9: 78,367,855 M55K possibly damaging Het
Ect2l A G 10: 18,130,718 V779A probably benign Het
Ehhadh A G 16: 21,763,184 S353P probably benign Het
Etv3 A G 3: 87,536,282 D391G probably benign Het
Fastkd1 T A 2: 69,707,310 K309N probably damaging Het
Fip1l1 T A 5: 74,588,191 Y375N probably damaging Het
Flvcr2 T C 12: 85,786,129 S308P probably benign Het
Gfra2 A G 14: 70,966,275 D31G probably damaging Het
Gm17175 A T 14: 51,573,077 I31N probably damaging Het
Gm6003 T A 7: 33,165,551 noncoding transcript Het
Gm9951 T C 8: 34,055,839 noncoding transcript Het
Hspa2 A G 12: 76,405,234 E234G probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Iqsec1 A T 6: 90,662,602 Y1065* probably null Het
Ltk T A 2: 119,757,948 probably benign Het
Map2 G A 1: 66,415,904 A1318T probably damaging Het
Mas1 A T 17: 12,842,346 N63K probably damaging Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nav3 A G 10: 109,903,744 probably null Het
Nlrp1c-ps T C 11: 71,242,533 noncoding transcript Het
Oca2 A T 7: 56,254,882 D32V probably damaging Het
Olfr624 T C 7: 103,671,014 T6A probably benign Het
Olfr877 T C 9: 37,855,409 L197S possibly damaging Het
Otub2 T C 12: 103,404,230 V257A probably damaging Het
Pink1 G A 4: 138,315,511 R461* probably null Het
Plxna2 T C 1: 194,780,627 C901R probably damaging Het
Ptchd3 T A 11: 121,830,746 N148K probably damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Ripor1 T A 8: 105,618,857 probably benign Het
Sec13 T C 6: 113,734,676 N107S probably damaging Het
Slc12a2 A G 18: 57,899,355 M376V possibly damaging Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Stradb T A 1: 58,980,009 Y30N possibly damaging Het
Syne1 T A 10: 5,409,798 Q328L probably damaging Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Vmn2r100 T C 17: 19,531,953 S753P probably damaging Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Vmn2r-ps159 G T 4: 156,334,483 noncoding transcript Het
Zfp936 A G 7: 43,190,206 T366A probably benign Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Fyco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Fyco1 APN 9 123838897 missense probably damaging 1.00
IGL01407:Fyco1 APN 9 123828879 missense probably damaging 1.00
IGL01621:Fyco1 APN 9 123827182 unclassified probably benign
IGL01908:Fyco1 APN 9 123829230 missense probably damaging 1.00
IGL02006:Fyco1 APN 9 123829831 nonsense probably null
IGL02899:Fyco1 APN 9 123830331 missense possibly damaging 0.47
IGL03166:Fyco1 APN 9 123828387 missense probably benign 0.00
IGL03272:Fyco1 APN 9 123829603 missense probably benign 0.00
BB009:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
BB019:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
PIT4480001:Fyco1 UTSW 9 123828650 nonsense probably null
R0013:Fyco1 UTSW 9 123822406 missense probably benign
R0025:Fyco1 UTSW 9 123829009 missense probably damaging 1.00
R0349:Fyco1 UTSW 9 123797662 missense probably damaging 0.98
R0751:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1184:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1563:Fyco1 UTSW 9 123827182 unclassified probably benign
R1618:Fyco1 UTSW 9 123829281 missense probably damaging 1.00
R1732:Fyco1 UTSW 9 123819092 missense probably benign 0.32
R1873:Fyco1 UTSW 9 123823238 missense probably benign
R1920:Fyco1 UTSW 9 123830413 missense probably damaging 1.00
R2108:Fyco1 UTSW 9 123797516 critical splice donor site probably null
R2849:Fyco1 UTSW 9 123834826 nonsense probably null
R2944:Fyco1 UTSW 9 123826648 missense probably benign 0.02
R4035:Fyco1 UTSW 9 123801283 missense probably benign 0.00
R4198:Fyco1 UTSW 9 123826634 missense probably benign
R4534:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4535:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4536:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R5408:Fyco1 UTSW 9 123829503 missense probably damaging 0.99
R5522:Fyco1 UTSW 9 123794771 nonsense probably null
R5755:Fyco1 UTSW 9 123828708 missense possibly damaging 0.71
R5781:Fyco1 UTSW 9 123794833 missense probably damaging 1.00
R5813:Fyco1 UTSW 9 123831348 missense probably damaging 1.00
R7090:Fyco1 UTSW 9 123797719 missense probably damaging 0.98
R7205:Fyco1 UTSW 9 123822426 missense probably benign 0.00
R7932:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
R8086:Fyco1 UTSW 9 123830406 missense probably damaging 1.00
R8103:Fyco1 UTSW 9 123829388 missense probably benign 0.17
R8504:Fyco1 UTSW 9 123830077 missense probably benign 0.08
R8530:Fyco1 UTSW 9 123840540 critical splice donor site probably null
R8822:Fyco1 UTSW 9 123819119 missense probably damaging 1.00
R8899:Fyco1 UTSW 9 123826581 missense probably benign 0.00
Z1177:Fyco1 UTSW 9 123828323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGGGCCCATTTCCACTG -3'
(R):5'- TCACGGTAAGCAGATCGTG -3'

Sequencing Primer
(F):5'- AGGGCCCATTTCCACTGAACTG -3'
(R):5'- GATCGTGCCTCACCAAGAG -3'
Posted On2015-05-14