Incidental Mutation 'R4120:Gfra2'
ID315297
Institutional Source Beutler Lab
Gene Symbol Gfra2
Ensembl Gene ENSMUSG00000022103
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 2
SynonymsGFR alpha-2, GFR alpha 2
MMRRC Submission 040993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R4120 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70890120-70979838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70966275 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 31 (D31G)
Ref Sequence ENSEMBL: ENSMUSP00000153937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022699] [ENSMUST00000227633] [ENSMUST00000227697]
Predicted Effect probably damaging
Transcript: ENSMUST00000022699
AA Change: D288G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022699
Gene: ENSMUSG00000022103
AA Change: D288G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
GDNF 40 117 1.76e-15 SMART
GDNF 161 241 3.7e-23 SMART
GDNF 251 347 1.74e-28 SMART
low complexity region 381 397 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227633
AA Change: D31G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227697
AA Change: D155G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.3278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants have dry eyes, poor postweaning growth associated with impaired parasympathetic cholinergic innervation of lacrimal and salivary glands and of small intestine, reduced skin thickness and accelerated hair follicle regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 C A 1: 25,094,307 E1233* probably null Het
Afap1l1 T C 18: 61,739,172 D526G probably damaging Het
Ago4 A G 4: 126,496,807 Y807H probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap40 A G 2: 158,532,330 M222V probably benign Het
Asnsd1 A G 1: 53,347,995 S158P probably damaging Het
C130026I21Rik C T 1: 85,259,821 V81M possibly damaging Het
Cdh15 T C 8: 122,863,423 V365A probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Col4a1 G A 8: 11,206,263 P1535S unknown Het
Dennd2a G A 6: 39,465,096 R947C probably damaging Het
Dlg2 G A 7: 91,965,638 V217I probably damaging Het
Dnaaf2 T C 12: 69,198,038 D83G possibly damaging Het
Dppa5a A T 9: 78,367,855 M55K possibly damaging Het
Ect2l A G 10: 18,130,718 V779A probably benign Het
Ehhadh A G 16: 21,763,184 S353P probably benign Het
Etv3 A G 3: 87,536,282 D391G probably benign Het
Fastkd1 T A 2: 69,707,310 K309N probably damaging Het
Fip1l1 T A 5: 74,588,191 Y375N probably damaging Het
Flvcr2 T C 12: 85,786,129 S308P probably benign Het
Fyco1 T C 9: 123,825,626 Y1065C probably benign Het
Gm17175 A T 14: 51,573,077 I31N probably damaging Het
Gm6003 T A 7: 33,165,551 noncoding transcript Het
Gm9951 T C 8: 34,055,839 noncoding transcript Het
Hspa2 A G 12: 76,405,234 E234G probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Iqsec1 A T 6: 90,662,602 Y1065* probably null Het
Ltk T A 2: 119,757,948 probably benign Het
Map2 G A 1: 66,415,904 A1318T probably damaging Het
Mas1 A T 17: 12,842,346 N63K probably damaging Het
Myo15b T C 11: 115,873,492 S1311P probably benign Het
Nav3 A G 10: 109,903,744 probably null Het
Nlrp1c-ps T C 11: 71,242,533 noncoding transcript Het
Oca2 A T 7: 56,254,882 D32V probably damaging Het
Olfr624 T C 7: 103,671,014 T6A probably benign Het
Olfr877 T C 9: 37,855,409 L197S possibly damaging Het
Otub2 T C 12: 103,404,230 V257A probably damaging Het
Pink1 G A 4: 138,315,511 R461* probably null Het
Plxna2 T C 1: 194,780,627 C901R probably damaging Het
Ptchd3 T A 11: 121,830,746 N148K probably damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Ripor1 T A 8: 105,618,857 probably benign Het
Sec13 T C 6: 113,734,676 N107S probably damaging Het
Slc12a2 A G 18: 57,899,355 M376V possibly damaging Het
Sptbn5 T A 2: 120,064,529 D798V possibly damaging Het
Stradb T A 1: 58,980,009 Y30N possibly damaging Het
Syne1 T A 10: 5,409,798 Q328L probably damaging Het
Ttc23l A C 15: 10,539,920 V159G probably damaging Het
Vmn2r100 T C 17: 19,531,953 S753P probably damaging Het
Vmn2r39 G A 7: 9,023,674 H443Y probably benign Het
Vmn2r-ps159 G T 4: 156,334,483 noncoding transcript Het
Zfp936 A G 7: 43,190,206 T366A probably benign Het
Zkscan3 T C 13: 21,393,949 E256G possibly damaging Het
Other mutations in Gfra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gfra2 APN 14 70968239 splice site probably benign
IGL01303:Gfra2 APN 14 70895852 missense probably benign 0.09
IGL01380:Gfra2 APN 14 70967146 splice site probably benign
IGL01528:Gfra2 APN 14 70966298 missense possibly damaging 0.95
IGL02203:Gfra2 APN 14 70967084 missense possibly damaging 0.69
IGL02270:Gfra2 APN 14 70925907 missense possibly damaging 0.78
IGL03104:Gfra2 APN 14 70968285 missense probably benign 0.00
IGL03270:Gfra2 APN 14 70925904 missense possibly damaging 0.80
H8562:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
H8786:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
R0423:Gfra2 UTSW 14 70896081 missense probably damaging 1.00
R4172:Gfra2 UTSW 14 70896081 missense possibly damaging 0.80
R4712:Gfra2 UTSW 14 70925937 missense probably damaging 1.00
R4804:Gfra2 UTSW 14 70925921 missense possibly damaging 0.76
R4902:Gfra2 UTSW 14 70967015 missense probably damaging 1.00
R5424:Gfra2 UTSW 14 70895847 missense probably damaging 1.00
R6711:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R7290:Gfra2 UTSW 14 70925940 missense probably damaging 1.00
R7322:Gfra2 UTSW 14 70968391 missense probably benign 0.00
R7814:Gfra2 UTSW 14 70895970 missense probably damaging 1.00
Z1177:Gfra2 UTSW 14 70978492 missense not run
Predicted Primers PCR Primer
(F):5'- ATTGCACTATGCCCAGCTCC -3'
(R):5'- AGGCAAGGTTATGCTGTCAATCTC -3'

Sequencing Primer
(F):5'- TATGCCCAGCTCCATAGGC -3'
(R):5'- AAGGTTATGCTGTCAATCTCCCAAC -3'
Posted On2015-05-14