Incidental Mutation 'R4124:Aldh7a1'
ID315334
Institutional Source Beutler Lab
Gene Symbol Aldh7a1
Ensembl Gene ENSMUSG00000053644
Gene Namealdehyde dehydrogenase family 7, member A1
SynonymsD18Wsu181e, Atq1
MMRRC Submission 041632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4124 (G1)
Quality Score219
Status Validated
Chromosome18
Chromosomal Location56509687-56572951 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 56537323 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066208] [ENSMUST00000172734] [ENSMUST00000174518] [ENSMUST00000174704]
Predicted Effect probably benign
Transcript: ENSMUST00000066208
SMART Domains Protein: ENSMUSP00000065089
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 59 522 1.2e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168517
Predicted Effect probably benign
Transcript: ENSMUST00000170309
SMART Domains Protein: ENSMUSP00000127625
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 60 155 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172734
SMART Domains Protein: ENSMUSP00000134192
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 59 340 6.3e-74 PFAM
Pfam:Aldedh 338 458 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174518
SMART Domains Protein: ENSMUSP00000133372
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 31 494 7.3e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174704
SMART Domains Protein: ENSMUSP00000133970
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 57 293 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183892
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,993,921 M338K probably damaging Het
4933409G03Rik T A 2: 68,616,224 probably benign Het
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Ank T C 15: 27,571,623 F327S probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Cd6 G T 19: 10,790,608 P630T probably damaging Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
D630003M21Rik C T 2: 158,196,593 V978M probably damaging Het
Dsp A G 13: 38,186,713 D864G probably damaging Het
Duox1 A G 2: 122,337,421 R1062G probably damaging Het
Fbp2 T C 13: 62,854,941 E99G probably damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Gpx6 C T 13: 21,317,645 Q146* probably null Het
Grid2 A T 6: 63,503,433 Q77L probably benign Het
Hrh1 T C 6: 114,480,619 V287A probably benign Het
Kmt2a T C 9: 44,819,796 probably benign Het
Mak A T 13: 41,056,630 D43E probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Poln A G 5: 34,103,951 S561P probably benign Het
Ptpn11 T C 5: 121,137,457 S562G probably benign Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rpgrip1 T C 14: 52,152,324 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slamf9 T C 1: 172,476,241 I51T probably damaging Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tgtp2 T C 11: 49,059,411 I111M probably damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Vmn1r215 A T 13: 23,075,993 T68S probably benign Het
Ypel2 A G 11: 86,945,927 probably null Het
Other mutations in Aldh7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Aldh7a1 APN 18 56528355 splice site probably benign
IGL02887:Aldh7a1 APN 18 56542216 intron probably benign
R0462:Aldh7a1 UTSW 18 56534214 unclassified probably null
R0595:Aldh7a1 UTSW 18 56546893 splice site probably benign
R0657:Aldh7a1 UTSW 18 56537197 splice site probably benign
R0947:Aldh7a1 UTSW 18 56560838 splice site probably null
R1295:Aldh7a1 UTSW 18 56546950 critical splice acceptor site probably null
R1385:Aldh7a1 UTSW 18 56542285 missense probably damaging 1.00
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1517:Aldh7a1 UTSW 18 56532061 missense probably damaging 0.99
R1550:Aldh7a1 UTSW 18 56550382 missense possibly damaging 0.49
R3552:Aldh7a1 UTSW 18 56550292 splice site probably null
R3953:Aldh7a1 UTSW 18 56548505 missense probably damaging 0.99
R4296:Aldh7a1 UTSW 18 56544963 critical splice donor site probably null
R4355:Aldh7a1 UTSW 18 56548494 missense probably null 0.09
R4549:Aldh7a1 UTSW 18 56531994 missense probably benign 0.09
R4851:Aldh7a1 UTSW 18 56532016 missense possibly damaging 0.95
R5288:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5384:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5385:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5547:Aldh7a1 UTSW 18 56528284 missense probably damaging 1.00
R6505:Aldh7a1 UTSW 18 56526996 missense probably damaging 1.00
R7373:Aldh7a1 UTSW 18 56542317 missense possibly damaging 0.48
R7861:Aldh7a1 UTSW 18 56548453 missense probably benign 0.03
R7944:Aldh7a1 UTSW 18 56548453 missense probably benign 0.03
Z1177:Aldh7a1 UTSW 18 56526991 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGACAGGATTCATTGAACTGAAG -3'
(R):5'- TCTGGGTACAGTTCGGAGAC -3'

Sequencing Primer
(F):5'- CTCTTTCAGAAGACCCAAGTGTGG -3'
(R):5'- TACAGTTCGGAGACCCCTC -3'
Posted On2015-05-14