Incidental Mutation 'R4125:Slco6b1'
ID 315340
Institutional Source Beutler Lab
Gene Symbol Slco6b1
Ensembl Gene ENSMUSG00000045463
Gene Name solute carrier organic anion transporter family, member 6b1
Synonyms 1700022M03Rik
MMRRC Submission 041633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4125 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 96906176-96997577 bp(-) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) T to A at 96987897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178359
SMART Domains Protein: ENSMUSP00000136663
Gene: ENSMUSG00000045463

DomainStartEndE-ValueType
Pfam:MFS_1 103 481 1.6e-12 PFAM
Pfam:OATP 108 668 9.7e-128 PFAM
Pfam:Kazal_2 511 552 5.1e-8 PFAM
transmembrane domain 670 692 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 T A 3: 98,161,363 C43S probably damaging Het
Adamts6 A T 13: 104,312,904 Y274F probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Atm A C 9: 53,450,621 L2732R probably damaging Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Bmpr1a T C 14: 34,434,733 D112G probably benign Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Chuk T C 19: 44,100,174 I121V probably null Het
Ctsr A T 13: 61,161,845 D183E probably benign Het
Elp3 T C 14: 65,560,181 E347G possibly damaging Het
Fam160a1 A G 3: 85,665,383 S988P possibly damaging Het
Gm13078 C T 4: 143,726,280 R94* probably null Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Gramd3 T C 18: 56,485,224 S199P probably damaging Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Ifit1bl1 T A 19: 34,594,788 I90F probably damaging Het
Igf2r A T 17: 12,702,254 H1313Q possibly damaging Het
Ighj4 T C 12: 113,428,556 probably benign Het
Kansl2 G T 15: 98,531,755 P132Q possibly damaging Het
Lman1 T C 18: 65,987,861 H430R possibly damaging Het
Lrrk2 T C 15: 91,815,483 I2511T probably benign Het
Lvrn C A 18: 46,876,969 P395T possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Nectin4 A G 1: 171,385,733 S408G probably benign Het
Olfr629 T C 7: 103,741,000 K80R probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pcdhb13 T C 18: 37,443,820 I417T probably damaging Het
Per2 T C 1: 91,429,450 T664A possibly damaging Het
Plec A T 15: 76,172,762 L4347Q probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Polr1a T C 6: 71,965,706 F1177L probably benign Het
Ptprb A T 10: 116,353,849 R1804S probably benign Het
Rhof C T 5: 123,119,525 V181M probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc22a12 T C 19: 6,538,788 E281G probably damaging Het
Stac C A 9: 111,604,058 probably null Het
Tcof1 C A 18: 60,819,601 A898S unknown Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Thoc6 A T 17: 23,669,345 probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Tnpo3 A G 6: 29,560,092 L684P probably damaging Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Umps G A 16: 33,956,918 Q431* probably null Het
Unc13c A G 9: 73,574,007 probably null Het
Vmn1r210 A T 13: 22,827,609 M169K probably benign Het
Zfp946 C T 17: 22,454,567 Q101* probably null Het
Other mutations in Slco6b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slco6b1 APN 1 96988650 exon noncoding transcript
IGL02110:Slco6b1 APN 1 96987882 exon noncoding transcript
IGL02416:Slco6b1 APN 1 96924333 exon noncoding transcript
IGL03406:Slco6b1 APN 1 96947585 exon noncoding transcript
R0147:Slco6b1 UTSW 1 96987837 exon noncoding transcript
R0277:Slco6b1 UTSW 1 96988673 exon noncoding transcript
R0513:Slco6b1 UTSW 1 96997184 unclassified noncoding transcript
R1401:Slco6b1 UTSW 1 96929885 splice site noncoding transcript
R1823:Slco6b1 UTSW 1 96961176 exon noncoding transcript
R1888:Slco6b1 UTSW 1 96922061 splice site noncoding transcript
R4281:Slco6b1 UTSW 1 96997390 unclassified noncoding transcript
R4282:Slco6b1 UTSW 1 96997390 unclassified noncoding transcript
R4576:Slco6b1 UTSW 1 96988697 exon noncoding transcript
R4850:Slco6b1 UTSW 1 96911833 unclassified noncoding transcript
R5222:Slco6b1 UTSW 1 96997491 unclassified noncoding transcript
R5389:Slco6b1 UTSW 1 96988584 exon noncoding transcript
R5801:Slco6b1 UTSW 1 96947631 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGTGCACATCACCAGAAGTTG -3'
(R):5'- CTGCCCTACTAATTTGGGATTTGTTAG -3'

Sequencing Primer
(F):5'- GCACTATTTGTGAGTTACTC -3'
(R):5'- TGGGATTTGTTAGAATCAATTCCAG -3'
Posted On 2015-05-14