Incidental Mutation 'R4125:Chd9'
ID315356
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Namechromodomain helicase DNA binding protein 9
Synonyms1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik
MMRRC Submission 041633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4125 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location90828352-91054516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91051284 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2641 (D2641G)
Ref Sequence ENSEMBL: ENSMUSP00000046356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423]
Predicted Effect probably damaging
Transcript: ENSMUST00000048665
AA Change: D2641G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: D2641G

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109614
AA Change: D2657G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: D2657G

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209203
Predicted Effect probably damaging
Transcript: ENSMUST00000209423
AA Change: D2657G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210196
Meta Mutation Damage Score 0.3579 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 T A 3: 98,161,363 C43S probably damaging Het
Adamts6 A T 13: 104,312,904 Y274F probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Atm A C 9: 53,450,621 L2732R probably damaging Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Bmpr1a T C 14: 34,434,733 D112G probably benign Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Chuk T C 19: 44,100,174 I121V probably null Het
Ctsr A T 13: 61,161,845 D183E probably benign Het
Elp3 T C 14: 65,560,181 E347G possibly damaging Het
Fam160a1 A G 3: 85,665,383 S988P possibly damaging Het
Gm13078 C T 4: 143,726,280 R94* probably null Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Gramd3 T C 18: 56,485,224 S199P probably damaging Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Ifit1bl1 T A 19: 34,594,788 I90F probably damaging Het
Igf2r A T 17: 12,702,254 H1313Q possibly damaging Het
Ighj4 T C 12: 113,428,556 probably benign Het
Kansl2 G T 15: 98,531,755 P132Q possibly damaging Het
Lman1 T C 18: 65,987,861 H430R possibly damaging Het
Lrrk2 T C 15: 91,815,483 I2511T probably benign Het
Lvrn C A 18: 46,876,969 P395T possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Nectin4 A G 1: 171,385,733 S408G probably benign Het
Olfr629 T C 7: 103,741,000 K80R probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pcdhb13 T C 18: 37,443,820 I417T probably damaging Het
Per2 T C 1: 91,429,450 T664A possibly damaging Het
Plec A T 15: 76,172,762 L4347Q probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Polr1a T C 6: 71,965,706 F1177L probably benign Het
Ptprb A T 10: 116,353,849 R1804S probably benign Het
Rhof C T 5: 123,119,525 V181M probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc22a12 T C 19: 6,538,788 E281G probably damaging Het
Slco6b1 T A 1: 96,987,897 noncoding transcript Het
Stac C A 9: 111,604,058 probably null Het
Tcof1 C A 18: 60,819,601 A898S unknown Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Thoc6 A T 17: 23,669,345 probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Tnpo3 A G 6: 29,560,092 L684P probably damaging Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Umps G A 16: 33,956,918 Q431* probably null Het
Unc13c A G 9: 73,574,007 probably null Het
Vmn1r210 A T 13: 22,827,609 M169K probably benign Het
Zfp946 C T 17: 22,454,567 Q101* probably null Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91025392 missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91005798 missense probably damaging 1.00
IGL00589:Chd9 APN 8 91015846 missense probably damaging 1.00
IGL00640:Chd9 APN 8 90986132 missense probably damaging 0.99
IGL00663:Chd9 APN 8 90983490 missense probably damaging 1.00
IGL00852:Chd9 APN 8 90973207 missense probably benign 0.29
IGL00908:Chd9 APN 8 90996880 missense probably damaging 1.00
IGL00911:Chd9 APN 8 91051692 missense probably damaging 1.00
IGL01068:Chd9 APN 8 91042116 missense probably benign 0.13
IGL01668:Chd9 APN 8 91026776 missense possibly damaging 0.53
IGL01873:Chd9 APN 8 90933767 missense probably benign 0.00
IGL01969:Chd9 APN 8 91033510 missense possibly damaging 0.72
IGL02105:Chd9 APN 8 90932488 missense probably damaging 1.00
IGL02153:Chd9 APN 8 90956494 nonsense probably null
IGL02164:Chd9 APN 8 90933221 missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91051684 missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91033582 missense probably benign 0.33
IGL02892:Chd9 APN 8 90976915 splice site probably benign
IGL02897:Chd9 APN 8 90933868 splice site probably benign
IGL03005:Chd9 APN 8 91011447 missense probably damaging 0.98
IGL03062:Chd9 APN 8 91015267 splice site probably benign
IGL03140:Chd9 APN 8 91042228 missense possibly damaging 0.91
hovel UTSW 8 91015204 missense probably benign 0.19
shack UTSW 8 90932798 missense probably damaging 1.00
R0056:Chd9 UTSW 8 90933537 missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91008836 splice site probably null
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0432:Chd9 UTSW 8 90994450 splice site probably benign
R0454:Chd9 UTSW 8 90973231 missense possibly damaging 0.83
R0573:Chd9 UTSW 8 90998595 missense probably damaging 1.00
R0580:Chd9 UTSW 8 90994563 missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91036542 missense possibly damaging 0.82
R0662:Chd9 UTSW 8 90977676 missense probably damaging 0.99
R0825:Chd9 UTSW 8 91051197 missense probably benign 0.06
R0945:Chd9 UTSW 8 90933002 missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91015204 missense probably benign 0.19
R0967:Chd9 UTSW 8 90989479 missense probably damaging 1.00
R1015:Chd9 UTSW 8 90932578 missense probably damaging 0.99
R1066:Chd9 UTSW 8 90986136 nonsense probably null
R1244:Chd9 UTSW 8 91022929 missense probably damaging 0.99
R1505:Chd9 UTSW 8 91006495 intron probably null
R1570:Chd9 UTSW 8 91036542 missense probably benign 0.03
R1591:Chd9 UTSW 8 90983538 missense probably damaging 0.97
R1624:Chd9 UTSW 8 90998535 missense probably benign 0.17
R1626:Chd9 UTSW 8 90994596 missense probably benign 0.00
R1632:Chd9 UTSW 8 90956707 nonsense probably null
R1649:Chd9 UTSW 8 90932601 missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91022790 intron probably null
R1668:Chd9 UTSW 8 91041186 missense probably damaging 0.99
R1681:Chd9 UTSW 8 90973135 missense probably damaging 0.98
R1695:Chd9 UTSW 8 91001782 missense probably damaging 1.00
R1714:Chd9 UTSW 8 91034225 utr 3 prime probably benign
R1746:Chd9 UTSW 8 91010698 missense probably benign 0.01
R1843:Chd9 UTSW 8 91010794 missense probably benign 0.19
R1844:Chd9 UTSW 8 90956695 nonsense probably null
R1941:Chd9 UTSW 8 90977069 critical splice donor site probably null
R2022:Chd9 UTSW 8 91035054 missense probably benign 0.17
R2027:Chd9 UTSW 8 90907991 unclassified probably benign
R2098:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2099:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2100:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2101:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2224:Chd9 UTSW 8 91011285 missense probably benign 0.04
R2276:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2278:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2316:Chd9 UTSW 8 91051128 missense probably damaging 0.99
R2507:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2508:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2988:Chd9 UTSW 8 91030460 intron probably null
R3418:Chd9 UTSW 8 91036591 missense probably damaging 1.00
R3817:Chd9 UTSW 8 90984265 splice site probably benign
R3923:Chd9 UTSW 8 90933519 missense probably benign 0.16
R4001:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4003:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4006:Chd9 UTSW 8 90933560 missense probably benign 0.12
R4013:Chd9 UTSW 8 90973169 missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91023574 missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91010676 missense probably benign 0.04
R4126:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4452:Chd9 UTSW 8 90977680 missense probably damaging 0.99
R4463:Chd9 UTSW 8 90978999 missense probably benign 0.01
R4478:Chd9 UTSW 8 91034031 utr 3 prime probably benign
R4587:Chd9 UTSW 8 91036506 missense possibly damaging 0.95
R4628:Chd9 UTSW 8 90983463 missense probably benign 0.05
R4667:Chd9 UTSW 8 91033800 missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91015249 missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91034230 missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91033708 missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91006626 nonsense probably null
R5083:Chd9 UTSW 8 90984374 missense probably damaging 1.00
R5088:Chd9 UTSW 8 90977519 missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91026834 nonsense probably null
R5307:Chd9 UTSW 8 90997149 missense probably damaging 1.00
R5541:Chd9 UTSW 8 91051504 missense probably benign 0.09
R5559:Chd9 UTSW 8 91015925 critical splice donor site probably null
R5638:Chd9 UTSW 8 91011450 missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91036562 missense probably damaging 1.00
R5793:Chd9 UTSW 8 91001756 missense probably damaging 1.00
R5827:Chd9 UTSW 8 90989450 missense probably damaging 1.00
R5834:Chd9 UTSW 8 90997164 missense probably damaging 1.00
R5875:Chd9 UTSW 8 91051836 missense probably damaging 0.99
R6002:Chd9 UTSW 8 90978887 missense probably damaging 1.00
R6091:Chd9 UTSW 8 91035063 missense probably damaging 1.00
R6185:Chd9 UTSW 8 91049137 missense probably damaging 1.00
R6246:Chd9 UTSW 8 90932417 missense probably damaging 1.00
R6292:Chd9 UTSW 8 90932922 missense probably benign 0.05
R6305:Chd9 UTSW 8 91030546 missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91011275 missense possibly damaging 0.95
R6438:Chd9 UTSW 8 90998521 missense probably benign 0.02
R6470:Chd9 UTSW 8 90932798 missense probably damaging 1.00
R6798:Chd9 UTSW 8 91051554 missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91042951 missense probably damaging 1.00
R6908:Chd9 UTSW 8 90956416 missense probably benign 0.02
R6929:Chd9 UTSW 8 91042945 missense probably damaging 1.00
R6969:Chd9 UTSW 8 90978914 missense probably benign 0.34
R7043:Chd9 UTSW 8 91034215 utr 3 prime probably benign
R7094:Chd9 UTSW 8 90989561 missense unknown
R7126:Chd9 UTSW 8 91015225 missense unknown
R7182:Chd9 UTSW 8 91006622 missense unknown
R7219:Chd9 UTSW 8 91001766 missense unknown
R7260:Chd9 UTSW 8 90994543 missense unknown
R7293:Chd9 UTSW 8 91034079 missense unknown
R7303:Chd9 UTSW 8 91051904 missense unknown
R7358:Chd9 UTSW 8 90983487 missense unknown
R7358:Chd9 UTSW 8 91034218 missense unknown
R7451:Chd9 UTSW 8 91033790 frame shift probably null
R7451:Chd9 UTSW 8 91033818 missense probably benign 0.27
R7456:Chd9 UTSW 8 90932525 nonsense probably null
R7481:Chd9 UTSW 8 90956438 missense unknown
R7532:Chd9 UTSW 8 90994565 missense unknown
R7570:Chd9 UTSW 8 90994580 missense unknown
R7611:Chd9 UTSW 8 91036389 missense probably damaging 1.00
R7673:Chd9 UTSW 8 91051697 missense probably damaging 0.96
R7723:Chd9 UTSW 8 91015209 missense unknown
R7739:Chd9 UTSW 8 91035025 missense probably damaging 1.00
R7759:Chd9 UTSW 8 90977550 critical splice donor site probably null
RF007:Chd9 UTSW 8 91033950 missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91036572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACTGATTTTATCTTCACGTAGC -3'
(R):5'- GATTTGGTAACCCGGCCATTC -3'

Sequencing Primer
(F):5'- CTCTAGGGGTTTCTTCCAGAAAG -3'
(R):5'- CCATTCCTGAGAACAGCATGGG -3'
Posted On2015-05-14