Mutagenetix > Incidental Mutation

Incidental Mutation 'R4125:Ap2b1'

315363

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

041633-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 83365645 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably null
Transcript: ENSMUST00000018875

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000018875

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065692

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065692

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104029

Predicted Effect

probably null
Transcript: ENSMUST00000176430

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000176430

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000176523

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000176523

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Meta Mutation Damage Score

0.9595

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (52/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam30	T	A	3: 98,161,363	C43S	probably damaging	Het
Adamts6	A	T	13: 104,312,904	Y274F	probably damaging	Het
Atm	A	C	9: 53,450,621	L2732R	probably damaging	Het
Bbox1	A	G	2: 110,270,180	V224A	probably benign	Het
Bmpr1a	T	C	14: 34,434,733	D112G	probably benign	Het
Cdk19	A	G	10: 40,394,395	I67V	probably benign	Het
Cds2	A	G	2: 132,297,271	T145A	probably benign	Het
Chd9	A	G	8: 91,051,284	D2641G	probably damaging	Het
Chn2	G	T	6: 54,272,978	R24M	probably damaging	Het
Chuk	T	C	19: 44,100,174	I121V	probably null	Het
Ctsr	A	T	13: 61,161,845	D183E	probably benign	Het
Elp3	T	C	14: 65,560,181	E347G	possibly damaging	Het
Fam160a1	A	G	3: 85,665,383	S988P	possibly damaging	Het
Gm13078	C	T	4: 143,726,280	R94*	probably null	Het
Gnas	A	G	2: 174,300,165	N709S	possibly damaging	Het
Gramd3	T	C	18: 56,485,224	S199P	probably damaging	Het
Gtf3c1	A	T	7: 125,647,450	C1562*	probably null	Het
Ifit1bl1	T	A	19: 34,594,788	I90F	probably damaging	Het
Igf2r	A	T	17: 12,702,254	H1313Q	possibly damaging	Het
Ighj4	T	C	12: 113,428,556		probably benign	Het
Kansl2	G	T	15: 98,531,755	P132Q	possibly damaging	Het
Lman1	T	C	18: 65,987,861	H430R	possibly damaging	Het
Lrrk2	T	C	15: 91,815,483	I2511T	probably benign	Het
Lvrn	C	A	18: 46,876,969	P395T	possibly damaging	Het
Myrip	C	A	9: 120,464,698	S753*	probably null	Het
Nectin4	A	G	1: 171,385,733	S408G	probably benign	Het
Olfr629	T	C	7: 103,741,000	K80R	probably benign	Het
Olfr761	A	G	17: 37,952,790	I78T	probably benign	Het
Pcdhb13	T	C	18: 37,443,820	I417T	probably damaging	Het
Per2	T	C	1: 91,429,450	T664A	possibly damaging	Het
Plec	A	T	15: 76,172,762	L4347Q	probably damaging	Het
Poln	A	G	5: 34,103,951	S561P	probably benign	Het
Polr1a	T	C	6: 71,965,706	F1177L	probably benign	Het
Ptprb	A	T	10: 116,353,849	R1804S	probably benign	Het
Rhof	C	T	5: 123,119,525	V181M	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc22a12	T	C	19: 6,538,788	E281G	probably damaging	Het
Slco6b1	T	A	1: 96,987,897		noncoding transcript	Het
Stac	C	A	9: 111,604,058		probably null	Het
Tcof1	C	A	18: 60,819,601	A898S	unknown	Het
Tep1	C	T	14: 50,843,734	R1349Q	possibly damaging	Het
Thoc6	A	T	17: 23,669,345		probably benign	Het
Tmem179	A	T	12: 112,511,027	F8I	possibly damaging	Het
Tnpo3	A	G	6: 29,560,092	L684P	probably damaging	Het
Ubash3a	T	C	17: 31,237,275	Y506H	probably damaging	Het
Umps	G	A	16: 33,956,918	Q431*	probably null	Het
Unc13c	A	G	9: 73,574,007		probably null	Het
Vmn1r210	A	T	13: 22,827,609	M169K	probably benign	Het
Zfp946	C	T	17: 22,454,567	Q101*	probably null	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGATCACTGTGTTCTTGCATC -3'
(R):5'- CTGAAAAGGTGTTGCTCAGC -3'

Sequencing Primer
(F):5'- TGTGCCTTGACAAAGCCTCTAAAG -3'
(R):5'- AGCTACCTACTTACCGCCTTAGGAG -3'

Posted On

2015-05-14