Incidental Mutation 'R4125:Igf2r'
ID 315375
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 041633-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # R4125 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12702254 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1313 (H1313Q)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect possibly damaging
Transcript: ENSMUST00000024599
AA Change: H1313Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: H1313Q

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161738
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Meta Mutation Damage Score 0.4626 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 T A 3: 98,161,363 (GRCm38) C43S probably damaging Het
Adamts6 A T 13: 104,312,904 (GRCm38) Y274F probably damaging Het
Ap2b1 A G 11: 83,365,645 (GRCm38) probably null Het
Atm A C 9: 53,450,621 (GRCm38) L2732R probably damaging Het
Bbox1 A G 2: 110,270,180 (GRCm38) V224A probably benign Het
Bmpr1a T C 14: 34,434,733 (GRCm38) D112G probably benign Het
Cdk19 A G 10: 40,394,395 (GRCm38) I67V probably benign Het
Cds2 A G 2: 132,297,271 (GRCm38) T145A probably benign Het
Chd9 A G 8: 91,051,284 (GRCm38) D2641G probably damaging Het
Chn2 G T 6: 54,272,978 (GRCm38) R24M probably damaging Het
Chuk T C 19: 44,100,174 (GRCm38) I121V probably null Het
Ctsr A T 13: 61,161,845 (GRCm38) D183E probably benign Het
Elp3 T C 14: 65,560,181 (GRCm38) E347G possibly damaging Het
Fhip1a A G 3: 85,665,383 (GRCm38) S988P possibly damaging Het
Gnas A G 2: 174,300,165 (GRCm38) N709S possibly damaging Het
Gramd2b T C 18: 56,485,224 (GRCm38) S199P probably damaging Het
Gtf3c1 A T 7: 125,647,450 (GRCm38) C1562* probably null Het
Ifit1bl1 T A 19: 34,594,788 (GRCm38) I90F probably damaging Het
Ighj4 T C 12: 113,428,556 (GRCm38) probably benign Het
Kansl2 G T 15: 98,531,755 (GRCm38) P132Q possibly damaging Het
Lman1 T C 18: 65,987,861 (GRCm38) H430R possibly damaging Het
Lrrk2 T C 15: 91,815,483 (GRCm38) I2511T probably benign Het
Lvrn C A 18: 46,876,969 (GRCm38) P395T possibly damaging Het
Myrip C A 9: 120,464,698 (GRCm38) S753* probably null Het
Nectin4 A G 1: 171,385,733 (GRCm38) S408G probably benign Het
Or14j8 A G 17: 37,952,790 (GRCm38) I78T probably benign Het
Or52ae9 T C 7: 103,741,000 (GRCm38) K80R probably benign Het
Pcdhb13 T C 18: 37,443,820 (GRCm38) I417T probably damaging Het
Per2 T C 1: 91,429,450 (GRCm38) T664A possibly damaging Het
Plec A T 15: 76,172,762 (GRCm38) L4347Q probably damaging Het
Poln A G 5: 34,103,951 (GRCm38) S561P probably benign Het
Polr1a T C 6: 71,965,706 (GRCm38) F1177L probably benign Het
Pramel24 C T 4: 143,726,280 (GRCm38) R94* probably null Het
Ptprb A T 10: 116,353,849 (GRCm38) R1804S probably benign Het
Rhof C T 5: 123,119,525 (GRCm38) V181M probably damaging Het
Rufy4 T C 1: 74,147,663 (GRCm38) C537R probably damaging Het
Slc22a12 T C 19: 6,538,788 (GRCm38) E281G probably damaging Het
Slco6b1 T A 1: 96,987,897 (GRCm38) noncoding transcript Het
Stac C A 9: 111,604,058 (GRCm38) probably null Het
Tcof1 C A 18: 60,819,601 (GRCm38) A898S unknown Het
Tep1 C T 14: 50,843,734 (GRCm38) R1349Q possibly damaging Het
Thoc6 A T 17: 23,669,345 (GRCm38) probably benign Het
Tmem179 A T 12: 112,511,027 (GRCm38) F8I possibly damaging Het
Tnpo3 A G 6: 29,560,092 (GRCm38) L684P probably damaging Het
Ubash3a T C 17: 31,237,275 (GRCm38) Y506H probably damaging Het
Umps G A 16: 33,956,918 (GRCm38) Q431* probably null Het
Unc13c A G 9: 73,574,007 (GRCm38) probably null Het
Vmn1r210 A T 13: 22,827,609 (GRCm38) M169K probably benign Het
Zfp946 C T 17: 22,454,567 (GRCm38) Q101* probably null Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,713,990 (GRCm38) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,739,328 (GRCm38) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,700,358 (GRCm38) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,683,867 (GRCm38) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,704,775 (GRCm38) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,695,374 (GRCm38) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,704,349 (GRCm38) missense probably benign
IGL01557:Igf2r APN 17 12,704,635 (GRCm38) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,683,985 (GRCm38) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,725,415 (GRCm38) nonsense probably null
IGL01720:Igf2r APN 17 12,701,313 (GRCm38) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,683,822 (GRCm38) missense probably benign
IGL01839:Igf2r APN 17 12,705,022 (GRCm38) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,714,911 (GRCm38) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,704,338 (GRCm38) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,693,192 (GRCm38) nonsense probably null
IGL02095:Igf2r APN 17 12,702,005 (GRCm38) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,698,516 (GRCm38) unclassified probably benign
IGL02576:Igf2r APN 17 12,748,763 (GRCm38) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,712,087 (GRCm38) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,719,883 (GRCm38) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,692,723 (GRCm38) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,694,120 (GRCm38) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,710,746 (GRCm38) splice site probably benign
IGL03080:Igf2r APN 17 12,726,676 (GRCm38) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,716,672 (GRCm38) missense probably damaging 1.00
blunt UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
brusque UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
gruff UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
outlier UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
NA:Igf2r UTSW 17 12,691,962 (GRCm38) missense probably benign
R0165:Igf2r UTSW 17 12,698,527 (GRCm38) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,683,948 (GRCm38) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,692,064 (GRCm38) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,717,274 (GRCm38) splice site probably null
R0722:Igf2r UTSW 17 12,715,495 (GRCm38) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,692,101 (GRCm38) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,694,124 (GRCm38) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,717,269 (GRCm38) splice site probably benign
R1485:Igf2r UTSW 17 12,691,285 (GRCm38) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,726,309 (GRCm38) missense probably benign
R1693:Igf2r UTSW 17 12,704,316 (GRCm38) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,697,441 (GRCm38) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,704,270 (GRCm38) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,733,903 (GRCm38) nonsense probably null
R1994:Igf2r UTSW 17 12,692,738 (GRCm38) missense probably benign
R2060:Igf2r UTSW 17 12,701,319 (GRCm38) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,698,251 (GRCm38) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,722,208 (GRCm38) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,715,943 (GRCm38) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,722,311 (GRCm38) splice site probably null
R2696:Igf2r UTSW 17 12,695,344 (GRCm38) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,709,468 (GRCm38) missense probably benign
R3930:Igf2r UTSW 17 12,705,829 (GRCm38) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,748,751 (GRCm38) missense probably damaging 0.97
R4342:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,703,465 (GRCm38) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,684,126 (GRCm38) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,701,353 (GRCm38) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,691,877 (GRCm38) splice site probably null
R4980:Igf2r UTSW 17 12,703,360 (GRCm38) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,725,416 (GRCm38) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,693,145 (GRCm38) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,739,334 (GRCm38) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,717,367 (GRCm38) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,698,352 (GRCm38) splice site probably null
R5794:Igf2r UTSW 17 12,709,445 (GRCm38) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,714,113 (GRCm38) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,683,900 (GRCm38) missense probably benign
R6396:Igf2r UTSW 17 12,714,090 (GRCm38) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,701,250 (GRCm38) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6591:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,698,618 (GRCm38) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6691:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,714,944 (GRCm38) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,714,082 (GRCm38) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,703,376 (GRCm38) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,697,341 (GRCm38) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,718,718 (GRCm38) missense probably benign
R7030:Igf2r UTSW 17 12,733,866 (GRCm38) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,698,325 (GRCm38) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,704,323 (GRCm38) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,714,116 (GRCm38) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,703,484 (GRCm38) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,698,228 (GRCm38) nonsense probably null
R7463:Igf2r UTSW 17 12,710,645 (GRCm38) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,698,273 (GRCm38) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,735,991 (GRCm38) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,739,369 (GRCm38) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,748,704 (GRCm38) missense probably benign
R8022:Igf2r UTSW 17 12,718,795 (GRCm38) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,701,238 (GRCm38) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,692,071 (GRCm38) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,733,860 (GRCm38) missense probably benign
R8359:Igf2r UTSW 17 12,683,861 (GRCm38) missense probably benign
R8500:Igf2r UTSW 17 12,709,441 (GRCm38) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,704,313 (GRCm38) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,704,637 (GRCm38) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,701,244 (GRCm38) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,726,772 (GRCm38) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,716,650 (GRCm38) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,751,293 (GRCm38) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,691,213 (GRCm38) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,739,351 (GRCm38) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,695,353 (GRCm38) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,705,759 (GRCm38) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,698,328 (GRCm38) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,686,754 (GRCm38) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,694,140 (GRCm38) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,726,701 (GRCm38) missense probably benign
X0028:Igf2r UTSW 17 12,704,913 (GRCm38) nonsense probably null
Z1177:Igf2r UTSW 17 12,697,399 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGAAACACTGGCTGGAAAG -3'
(R):5'- TACACTGTCACAGGTCTTGC -3'

Sequencing Primer
(F):5'- CCAGGTGAAGGATGGCCATG -3'
(R):5'- ACACTGTCACAGGTCTTGCATTAG -3'
Posted On 2015-05-14