Incidental Mutation 'R4125:Ubash3a'
ID315378
Institutional Source Beutler Lab
Gene Symbol Ubash3a
Ensembl Gene ENSMUSG00000042345
Gene Nameubiquitin associated and SH3 domain containing, A
Synonyms5830413C03Rik, Sts-2, TULA
MMRRC Submission 041633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4125 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31207873-31242202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31237275 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 506 (Y506H)
Ref Sequence ENSEMBL: ENSMUSP00000045890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048656]
PDB Structure
Crystal structure of the 2H-phosphatase domain of Sts-2 [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with tungstate. [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with phosphate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048656
AA Change: Y506H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045890
Gene: ENSMUSG00000042345
AA Change: Y506H

DomainStartEndE-ValueType
Pfam:UBA 23 57 2.6e-7 PFAM
SH3 241 302 5.53e-10 SMART
Pfam:His_Phos_1 402 601 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151620
Meta Mutation Damage Score 0.5822 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and healthy with no abnormalities detected in any of the hematopoietic lineages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 T A 3: 98,161,363 C43S probably damaging Het
Adamts6 A T 13: 104,312,904 Y274F probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Atm A C 9: 53,450,621 L2732R probably damaging Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Bmpr1a T C 14: 34,434,733 D112G probably benign Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Chuk T C 19: 44,100,174 I121V probably null Het
Ctsr A T 13: 61,161,845 D183E probably benign Het
Elp3 T C 14: 65,560,181 E347G possibly damaging Het
Fam160a1 A G 3: 85,665,383 S988P possibly damaging Het
Gm13078 C T 4: 143,726,280 R94* probably null Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Gramd3 T C 18: 56,485,224 S199P probably damaging Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Ifit1bl1 T A 19: 34,594,788 I90F probably damaging Het
Igf2r A T 17: 12,702,254 H1313Q possibly damaging Het
Ighj4 T C 12: 113,428,556 probably benign Het
Kansl2 G T 15: 98,531,755 P132Q possibly damaging Het
Lman1 T C 18: 65,987,861 H430R possibly damaging Het
Lrrk2 T C 15: 91,815,483 I2511T probably benign Het
Lvrn C A 18: 46,876,969 P395T possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Nectin4 A G 1: 171,385,733 S408G probably benign Het
Olfr629 T C 7: 103,741,000 K80R probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pcdhb13 T C 18: 37,443,820 I417T probably damaging Het
Per2 T C 1: 91,429,450 T664A possibly damaging Het
Plec A T 15: 76,172,762 L4347Q probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Polr1a T C 6: 71,965,706 F1177L probably benign Het
Ptprb A T 10: 116,353,849 R1804S probably benign Het
Rhof C T 5: 123,119,525 V181M probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc22a12 T C 19: 6,538,788 E281G probably damaging Het
Slco6b1 T A 1: 96,987,897 noncoding transcript Het
Stac C A 9: 111,604,058 probably null Het
Tcof1 C A 18: 60,819,601 A898S unknown Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Thoc6 A T 17: 23,669,345 probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Tnpo3 A G 6: 29,560,092 L684P probably damaging Het
Umps G A 16: 33,956,918 Q431* probably null Het
Unc13c A G 9: 73,574,007 probably null Het
Vmn1r210 A T 13: 22,827,609 M169K probably benign Het
Zfp946 C T 17: 22,454,567 Q101* probably null Het
Other mutations in Ubash3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ubash3a APN 17 31228186 missense probably benign
IGL01310:Ubash3a APN 17 31215142 missense probably benign 0.03
IGL01450:Ubash3a APN 17 31208231 missense probably damaging 1.00
IGL02429:Ubash3a APN 17 31241305 missense probably benign 0.00
IGL02458:Ubash3a APN 17 31231481 missense possibly damaging 0.94
IGL03014:Ubash3a UTSW 17 31239224 missense probably damaging 1.00
R1033:Ubash3a UTSW 17 31208212 missense probably damaging 1.00
R1700:Ubash3a UTSW 17 31215044 missense probably damaging 0.99
R2212:Ubash3a UTSW 17 31218034 missense probably damaging 1.00
R3800:Ubash3a UTSW 17 31231470 missense probably benign 0.24
R4127:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4128:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4224:Ubash3a UTSW 17 31237928 missense probably damaging 1.00
R4786:Ubash3a UTSW 17 31217964 missense probably benign 0.31
R5311:Ubash3a UTSW 17 31219717 missense probably damaging 0.99
R5782:Ubash3a UTSW 17 31235503 missense probably benign 0.05
R5804:Ubash3a UTSW 17 31208232 critical splice donor site probably null
R6244:Ubash3a UTSW 17 31239272 missense possibly damaging 0.90
R6263:Ubash3a UTSW 17 31215095 missense probably benign 0.22
R6574:Ubash3a UTSW 17 31232396 missense probably damaging 1.00
R6736:Ubash3a UTSW 17 31231415 missense probably benign
R7041:Ubash3a UTSW 17 31228210 missense probably benign 0.00
R7458:Ubash3a UTSW 17 31208165 missense probably benign 0.02
R7490:Ubash3a UTSW 17 31232312 missense probably damaging 1.00
R7991:Ubash3a UTSW 17 31237895 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTCTAGGTTTGTTGTATCCAAATGC -3'
(R):5'- GGTCAGCTTTATCAGGAATACCCC -3'

Sequencing Primer
(F):5'- CAAATGCTTGTTTCCATTGACCCAAG -3'
(R):5'- CATCTTCCATGCGTGGTCAGG -3'
Posted On2015-05-14