Incidental Mutation 'R4125:Tcof1'
ID315383
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
MMRRC Submission 041633-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4125 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60819601 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 898 (A898S)
Ref Sequence ENSEMBL: ENSMUSP00000134755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect unknown
Transcript: ENSMUST00000163446
AA Change: C985F
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: C985F

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175934
AA Change: A982S
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: A982S

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176630
AA Change: A946S
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: A946S

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177172
AA Change: A898S
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: A898S

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 T A 3: 98,161,363 C43S probably damaging Het
Adamts6 A T 13: 104,312,904 Y274F probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Atm A C 9: 53,450,621 L2732R probably damaging Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Bmpr1a T C 14: 34,434,733 D112G probably benign Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Chuk T C 19: 44,100,174 I121V probably null Het
Ctsr A T 13: 61,161,845 D183E probably benign Het
Elp3 T C 14: 65,560,181 E347G possibly damaging Het
Fam160a1 A G 3: 85,665,383 S988P possibly damaging Het
Gm13078 C T 4: 143,726,280 R94* probably null Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Gramd3 T C 18: 56,485,224 S199P probably damaging Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Ifit1bl1 T A 19: 34,594,788 I90F probably damaging Het
Igf2r A T 17: 12,702,254 H1313Q possibly damaging Het
Ighj4 T C 12: 113,428,556 probably benign Het
Kansl2 G T 15: 98,531,755 P132Q possibly damaging Het
Lman1 T C 18: 65,987,861 H430R possibly damaging Het
Lrrk2 T C 15: 91,815,483 I2511T probably benign Het
Lvrn C A 18: 46,876,969 P395T possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Nectin4 A G 1: 171,385,733 S408G probably benign Het
Olfr629 T C 7: 103,741,000 K80R probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pcdhb13 T C 18: 37,443,820 I417T probably damaging Het
Per2 T C 1: 91,429,450 T664A possibly damaging Het
Plec A T 15: 76,172,762 L4347Q probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Polr1a T C 6: 71,965,706 F1177L probably benign Het
Ptprb A T 10: 116,353,849 R1804S probably benign Het
Rhof C T 5: 123,119,525 V181M probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc22a12 T C 19: 6,538,788 E281G probably damaging Het
Slco6b1 T A 1: 96,987,897 noncoding transcript Het
Stac C A 9: 111,604,058 probably null Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Thoc6 A T 17: 23,669,345 probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Tnpo3 A G 6: 29,560,092 L684P probably damaging Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Umps G A 16: 33,956,918 Q431* probably null Het
Unc13c A G 9: 73,574,007 probably null Het
Vmn1r210 A T 13: 22,827,609 M169K probably benign Het
Zfp946 C T 17: 22,454,567 Q101* probably null Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7946:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8006:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8007:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8008:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8063:Tcof1 UTSW 18 60838762 missense probably damaging 1.00
RF001:Tcof1 UTSW 18 60835739 unclassified probably benign
RF005:Tcof1 UTSW 18 60833554 small insertion probably benign
RF007:Tcof1 UTSW 18 60833568 small insertion probably benign
RF009:Tcof1 UTSW 18 60835743 unclassified probably benign
RF010:Tcof1 UTSW 18 60835744 unclassified probably benign
RF011:Tcof1 UTSW 18 60835739 unclassified probably benign
RF013:Tcof1 UTSW 18 60835743 unclassified probably benign
RF015:Tcof1 UTSW 18 60833584 small insertion probably benign
RF016:Tcof1 UTSW 18 60833575 small insertion probably benign
RF022:Tcof1 UTSW 18 60835735 unclassified probably benign
RF024:Tcof1 UTSW 18 60835738 unclassified probably benign
RF027:Tcof1 UTSW 18 60835736 unclassified probably benign
RF029:Tcof1 UTSW 18 60835735 unclassified probably benign
RF029:Tcof1 UTSW 18 60835745 unclassified probably benign
RF030:Tcof1 UTSW 18 60833568 small insertion probably benign
RF030:Tcof1 UTSW 18 60833574 small insertion probably benign
RF030:Tcof1 UTSW 18 60835723 unclassified probably benign
RF031:Tcof1 UTSW 18 60833565 small insertion probably benign
RF031:Tcof1 UTSW 18 60835745 unclassified probably benign
RF035:Tcof1 UTSW 18 60833553 small insertion probably benign
RF036:Tcof1 UTSW 18 60828408 small insertion probably benign
RF036:Tcof1 UTSW 18 60835736 unclassified probably benign
RF038:Tcof1 UTSW 18 60833566 small insertion probably benign
RF040:Tcof1 UTSW 18 60828408 small insertion probably benign
RF040:Tcof1 UTSW 18 60833583 small insertion probably benign
RF041:Tcof1 UTSW 18 60833572 small insertion probably benign
RF041:Tcof1 UTSW 18 60833576 small insertion probably benign
RF043:Tcof1 UTSW 18 60833572 small insertion probably benign
RF050:Tcof1 UTSW 18 60833579 small insertion probably benign
RF051:Tcof1 UTSW 18 60833579 small insertion probably benign
RF053:Tcof1 UTSW 18 60835747 unclassified probably benign
RF056:Tcof1 UTSW 18 60833575 small insertion probably benign
RF057:Tcof1 UTSW 18 60833564 small insertion probably benign
RF057:Tcof1 UTSW 18 60833565 small insertion probably benign
RF057:Tcof1 UTSW 18 60833566 small insertion probably benign
RF057:Tcof1 UTSW 18 60833571 small insertion probably benign
RF060:Tcof1 UTSW 18 60835744 unclassified probably benign
RF060:Tcof1 UTSW 18 60835747 unclassified probably benign
RF063:Tcof1 UTSW 18 60833573 small insertion probably benign
RF064:Tcof1 UTSW 18 60833571 small insertion probably benign
RF064:Tcof1 UTSW 18 60833574 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGGGGTCTCTTGGCATC -3'
(R):5'- TGAAAGGCCAGCATGGTTGTG -3'

Sequencing Primer
(F):5'- TCCTCCTCGTCCTCGGAAGAAG -3'
(R):5'- TGTGTGTAGTCAGCAGCCC -3'
Posted On2015-05-14