Mutagenetix > Incidental Mutation

Incidental Mutation 'R4126:Atad3a'

315394

Institutional Source

Beutler Lab

Gene Symbol

Atad3a

Ensembl Gene

ENSMUSG00000029036

Gene Name

ATPase family, AAA domain containing 3A

Synonyms

Tob3, 2400004H09Rik

MMRRC Submission

041634-MU

Accession Numbers

Genbank: NM_179203; MGI:1919214

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4126 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155740641-155761093 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 155754061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000176043] [ENSMUST00000184913]

AlphaFold

Q925I1

Predicted Effect

probably benign
Transcript: ENSMUST00000030903

SMART Domains

Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036

Domain	Start	End	E-Value	Type
Pfam:DUF3523	26	285	9.5e-113	PFAM
AAA	343	482	4.43e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134317

Predicted Effect

probably benign
Transcript: ENSMUST00000175679

Predicted Effect

unknown
Transcript: ENSMUST00000176043
AA Change: F197I

SMART Domains

Protein: ENSMUSP00000135405
Gene: ENSMUSG00000029036
AA Change: F197I

Domain	Start	End	E-Value	Type
Pfam:DUF3523	20	193	5e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176839

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177066

Predicted Effect

probably benign
Transcript: ENSMUST00000184131

Predicted Effect

probably benign
Transcript: ENSMUST00000184913

SMART Domains

Protein: ENSMUSP00000138808
Gene: ENSMUSG00000029036

Domain	Start	End	E-Value	Type
Pfam:DUF3523	1	125	9.9e-43	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

89% (33/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed mitochondrial membrane protein that contributes to mitochondrial dynamics, nucleoid organization, protein translation, cell growth, and cholesterol metabolism. This gene is a member of the ATPase family AAA-domain containing 3 gene family which, in humans, includes two other paralogs. Naturally occurring mutations in this gene are associated with distinct neurological syndromes including Harel-Yoon syndrome. High-level expression of this gene is associated with poor survival in breast cancer patients. A homozygous knockout of the orthologous gene in mice results in embryonic lethality at day 7.5 due to growth retardation and defective development of the trophoblast lineage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele die around E7.5 exhibiting growth retardation, failure to gastrulate, and impaired development of the trophoblast lineage immediately after implantation. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	A	8: 60,531,669	W249R	probably benign	Het
Ank	G	A	15: 27,590,373	V348I	probably benign	Het
Bbox1	A	G	2: 110,270,180	V224A	probably benign	Het
Cdk5rap1	A	G	2: 154,368,895	C108R	probably damaging	Het
Cds2	A	G	2: 132,297,271	T145A	probably benign	Het
Celsr2	G	T	3: 108,402,097	A1614D	possibly damaging	Het
Chd9	A	G	8: 91,051,284	D2641G	probably damaging	Het
E2f8	T	C	7: 48,875,607	I206V	probably damaging	Het
Glyat	G	T	19: 12,651,479	V213F	probably benign	Het
Gpatch1	C	T	7: 35,293,654		probably null	Het
Jarid2	T	C	13: 44,902,256	S313P	probably damaging	Het
Kcnc1	T	C	7: 46,398,002	Y109H	probably damaging	Het
Kif12	C	T	4: 63,166,437	S548N	probably benign	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Myrip	C	A	9: 120,464,698	S753*	probably null	Het
Naalad2	T	C	9: 18,347,470	Y503C	probably damaging	Het
Nid1	T	C	13: 13,476,372	V498A	probably damaging	Het
Olfr1061	A	T	2: 86,413,224	I276N	probably damaging	Het
Parp8	C	A	13: 116,868,469	K685N	possibly damaging	Het
Prr14l	G	T	5: 32,828,003	H1383N	probably damaging	Het
Pxn	A	G	5: 115,546,907	R264G	probably damaging	Het
Slc6a20a	G	T	9: 123,660,533	F148L	probably damaging	Het
Spag11b	T	C	8: 19,141,379	S23P	possibly damaging	Het
Stac	C	A	9: 111,604,058		probably null	Het
Taf11	T	C	17: 27,901,772	K175E	possibly damaging	Het
Tll1	T	C	8: 64,118,014	R175G	possibly damaging	Het
Trip11	G	A	12: 101,895,698	Q203*	probably null	Het
Usp4	T	C	9: 108,360,117	V128A	probably benign	Het
Zfp788	T	C	7: 41,649,436	F479L	probably damaging	Het
Zmiz1	T	G	14: 25,656,930	S877A	possibly damaging	Het

Other mutations in Atad3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01620:Atad3a	APN	4	155746078	missense	probably damaging	0.98
IGL01982:Atad3a	APN	4	155753927	missense	possibly damaging	0.94
IGL02059:Atad3a	APN	4	155754750	splice site	probably benign
IGL02572:Atad3a	APN	4	155753584	missense	possibly damaging	0.61
IGL03086:Atad3a	APN	4	155748670	critical splice donor site	probably null
IGL03409:Atad3a	APN	4	155747350	missense	probably damaging	0.99
E2594:Atad3a	UTSW	4	155750933	unclassified	probably benign
FR4976:Atad3a	UTSW	4	155753939	missense	probably damaging	0.98
PIT4618001:Atad3a	UTSW	4	155750138	missense	probably benign	0.41
R0233:Atad3a	UTSW	4	155746067	missense	probably damaging	0.99
R0233:Atad3a	UTSW	4	155746067	missense	probably damaging	0.99
R0601:Atad3a	UTSW	4	155747407	missense	probably damaging	1.00
R0799:Atad3a	UTSW	4	155747470	missense	probably damaging	1.00
R1428:Atad3a	UTSW	4	155755682	missense	probably damaging	1.00
R1597:Atad3a	UTSW	4	155751435	critical splice donor site	probably null
R2188:Atad3a	UTSW	4	155751519	missense	probably damaging	0.99
R4564:Atad3a	UTSW	4	155747309	splice site	probably null
R5334:Atad3a	UTSW	4	155755689	missense	probably damaging	1.00
R6354:Atad3a	UTSW	4	155753945	missense	possibly damaging	0.58
R6481:Atad3a	UTSW	4	155753641	splice site	probably null
R7220:Atad3a	UTSW	4	155754041	missense	probably benign	0.02
R7689:Atad3a	UTSW	4	155756153	missense	probably damaging	0.98
R7949:Atad3a	UTSW	4	155748695	missense	possibly damaging	0.53
R8127:Atad3a	UTSW	4	155753939	missense	probably damaging	0.96
R8783:Atad3a	UTSW	4	155755695	missense	probably damaging	1.00
R8956:Atad3a	UTSW	4	155753597	missense	probably damaging	0.96
R9019:Atad3a	UTSW	4	155753595	missense	possibly damaging	0.91
R9636:Atad3a	UTSW	4	155749159	missense	possibly damaging	0.95
R9706:Atad3a	UTSW	4	155750472	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGACTCCAAGATGGTCTGGC -3'
(R):5'- AGGTTTCTGTCCTGATTATTCACG -3'

Sequencing Primer
(F):5'- CAAGATGGTCTGGCGGTGC -3'
(R):5'- CTGTGACACAATGCTGTC -3'

Posted On

2015-05-14