Incidental Mutation 'R4126:Aadat'
ID315402
Institutional Source Beutler Lab
Gene Symbol Aadat
Ensembl Gene ENSMUSG00000057228
Gene Nameaminoadipate aminotransferase
SynonymsKATII, Kat2, mKat-2
MMRRC Submission 041634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4126 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60505932-60545677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60531669 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 249 (W249R)
Ref Sequence ENSEMBL: ENSMUSP00000148060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079472] [ENSMUST00000209338]
Predicted Effect probably benign
Transcript: ENSMUST00000079472
AA Change: W242R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078436
Gene: ENSMUSG00000057228
AA Change: W242R

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 417 2.6e-22 PFAM
Pfam:Aminotran_MocR 124 424 7.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209338
AA Change: W249R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 89% (33/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are viable and display earlier eye opening and development of air righting and open field crossing responses, and transient hyperactivity and neuronal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank G A 15: 27,590,373 V348I probably benign Het
Atad3a A T 4: 155,754,061 probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cdk5rap1 A G 2: 154,368,895 C108R probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Celsr2 G T 3: 108,402,097 A1614D possibly damaging Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
E2f8 T C 7: 48,875,607 I206V probably damaging Het
Glyat G T 19: 12,651,479 V213F probably benign Het
Gpatch1 C T 7: 35,293,654 probably null Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnc1 T C 7: 46,398,002 Y109H probably damaging Het
Kif12 C T 4: 63,166,437 S548N probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Naalad2 T C 9: 18,347,470 Y503C probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr1061 A T 2: 86,413,224 I276N probably damaging Het
Parp8 C A 13: 116,868,469 K685N possibly damaging Het
Prr14l G T 5: 32,828,003 H1383N probably damaging Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Slc6a20a G T 9: 123,660,533 F148L probably damaging Het
Spag11b T C 8: 19,141,379 S23P possibly damaging Het
Stac C A 9: 111,604,058 probably null Het
Taf11 T C 17: 27,901,772 K175E possibly damaging Het
Tll1 T C 8: 64,118,014 R175G possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Usp4 T C 9: 108,360,117 V128A probably benign Het
Zfp788 T C 7: 41,649,436 F479L probably damaging Het
Zmiz1 T G 14: 25,656,930 S877A possibly damaging Het
Other mutations in Aadat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Aadat APN 8 60535758 missense probably benign 0.11
IGL01123:Aadat APN 8 60526614 missense probably benign 0.14
IGL01524:Aadat APN 8 60516072 missense probably damaging 0.97
IGL01767:Aadat APN 8 60507092 missense probably damaging 0.96
IGL02824:Aadat APN 8 60516022 missense probably benign 0.01
IGL03150:Aadat APN 8 60543562 missense probably damaging 0.97
IGL03356:Aadat APN 8 60531691 missense probably damaging 1.00
R0015:Aadat UTSW 8 60534571 splice site probably benign
R0294:Aadat UTSW 8 60534608 missense possibly damaging 0.77
R0533:Aadat UTSW 8 60531763 splice site probably benign
R0631:Aadat UTSW 8 60529445 splice site probably benign
R1585:Aadat UTSW 8 60526680 missense possibly damaging 0.67
R1728:Aadat UTSW 8 60526712 missense probably damaging 1.00
R1729:Aadat UTSW 8 60526712 missense probably damaging 1.00
R2051:Aadat UTSW 8 60507139 missense probably benign 0.00
R2362:Aadat UTSW 8 60532298 splice site probably benign
R3971:Aadat UTSW 8 60518581 missense probably damaging 1.00
R4736:Aadat UTSW 8 60540106 missense probably benign 0.30
R4739:Aadat UTSW 8 60540106 missense probably benign 0.30
R4750:Aadat UTSW 8 60526600 missense probably benign 0.10
R4874:Aadat UTSW 8 60516113 critical splice donor site probably null
R4884:Aadat UTSW 8 60526629 missense probably damaging 1.00
R5233:Aadat UTSW 8 60526622 missense probably benign 0.01
R5367:Aadat UTSW 8 60526596 missense probably damaging 1.00
R6920:Aadat UTSW 8 60529433 missense probably damaging 0.97
R7064:Aadat UTSW 8 60531712 missense probably damaging 1.00
R7194:Aadat UTSW 8 60526622 missense probably benign 0.01
R7316:Aadat UTSW 8 60526634 missense probably damaging 0.98
R7634:Aadat UTSW 8 60516068 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGGCATATTTAGCAAAGAAACCC -3'
(R):5'- AGAGAGTGAAATACCCACATGC -3'

Sequencing Primer
(F):5'- TATTTAGCAAAGAAACCCCAAGG -3'
(R):5'- GTGAAATACCCACATGCCTATTAATG -3'
Posted On2015-05-14