Incidental Mutation 'R4126:Myrip'
ID315408
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Namemyosin VIIA and Rab interacting protein
SynonymsA230081N12Rik, Slac2-c
MMRRC Submission 041634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4126 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120301513-120474841 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 120464698 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 753 (S753*)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
Predicted Effect probably null
Transcript: ENSMUST00000048121
AA Change: S753*
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: S753*

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 89% (33/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,531,669 W249R probably benign Het
Ank G A 15: 27,590,373 V348I probably benign Het
Atad3a A T 4: 155,754,061 probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cdk5rap1 A G 2: 154,368,895 C108R probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Celsr2 G T 3: 108,402,097 A1614D possibly damaging Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
E2f8 T C 7: 48,875,607 I206V probably damaging Het
Glyat G T 19: 12,651,479 V213F probably benign Het
Gpatch1 C T 7: 35,293,654 probably null Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnc1 T C 7: 46,398,002 Y109H probably damaging Het
Kif12 C T 4: 63,166,437 S548N probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Naalad2 T C 9: 18,347,470 Y503C probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr1061 A T 2: 86,413,224 I276N probably damaging Het
Parp8 C A 13: 116,868,469 K685N possibly damaging Het
Prr14l G T 5: 32,828,003 H1383N probably damaging Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Slc6a20a G T 9: 123,660,533 F148L probably damaging Het
Spag11b T C 8: 19,141,379 S23P possibly damaging Het
Stac C A 9: 111,604,058 probably null Het
Taf11 T C 17: 27,901,772 K175E possibly damaging Het
Tll1 T C 8: 64,118,014 R175G possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Usp4 T C 9: 108,360,117 V128A probably benign Het
Zfp788 T C 7: 41,649,436 F479L probably damaging Het
Zmiz1 T G 14: 25,656,930 S877A possibly damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTGTAGCGGTGGATAGAC -3'
(R):5'- GCAGATCCTAGATATTTGGCACC -3'

Sequencing Primer
(F):5'- GTGTTGAAGTGCACACCTGTAATCC -3'
(R):5'- AGATATTTGGCACCTTCCAGG -3'
Posted On2015-05-14