Incidental Mutation 'R4127:Rag1'
ID315424
Institutional Source Beutler Lab
Gene Symbol Rag1
Ensembl Gene ENSMUSG00000061311
Gene Namerecombination activating gene 1
SynonymsRag-1
MMRRC Submission 040860-MU
Accession Numbers

MGI:97848

Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101638282-101649501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101642071 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 909 (Y909H)
Ref Sequence ENSEMBL: ENSMUSP00000077584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078494] [ENSMUST00000160037] [ENSMUST00000160722]
PDB Structure
RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078494
AA Change: Y909H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077584
Gene: ENSMUSG00000061311
AA Change: Y909H

DomainStartEndE-ValueType
Pfam:RAG1_imp_bd 11 288 5.7e-120 PFAM
RING 290 328 1.39e-3 SMART
ZnF_C2H2 353 376 2.61e1 SMART
PDB:3GNB|A 389 464 3e-44 PDB
ZnF_C2H2 725 750 7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(10) Chemically induced(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Rag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rag1 APN 2 101642388 missense probably damaging 1.00
IGL01125:Rag1 APN 2 101642001 missense probably damaging 0.99
IGL01836:Rag1 APN 2 101641894 missense probably damaging 1.00
IGL02216:Rag1 APN 2 101643381 missense possibly damaging 0.91
IGL02271:Rag1 APN 2 101643388 missense probably damaging 0.99
IGL02293:Rag1 APN 2 101643046 missense probably benign 0.39
IGL02601:Rag1 APN 2 101642673 missense probably damaging 1.00
anne UTSW 2 101643516 missense probably damaging 0.99
busted UTSW 2 101641947 missense probably damaging 1.00
defective UTSW 2 101642710 missense probably damaging 1.00
doll UTSW 2 101642070 missense probably damaging 1.00
dysfunctional UTSW 2 101644284 missense probably damaging 1.00
huckle UTSW 2 101641223 intron probably benign
maladaptive UTSW 2 101645647 intron probably benign
scarecrow UTSW 2 101642507 missense probably damaging 1.00
R0658:Rag1 UTSW 2 101642683 missense probably damaging 0.99
R1126:Rag1 UTSW 2 101642689 missense probably damaging 1.00
R1177:Rag1 UTSW 2 101642278 missense probably benign 0.10
R1319:Rag1 UTSW 2 101643192 missense probably damaging 1.00
R1513:Rag1 UTSW 2 101642991 missense possibly damaging 0.95
R1859:Rag1 UTSW 2 101644062 missense probably benign 0.03
R2218:Rag1 UTSW 2 101644146 missense probably benign
R3932:Rag1 UTSW 2 101643039 missense probably damaging 1.00
R4365:Rag1 UTSW 2 101642943 missense probably damaging 1.00
R4620:Rag1 UTSW 2 101643680 missense probably damaging 1.00
R4815:Rag1 UTSW 2 101643516 missense probably damaging 0.99
R5070:Rag1 UTSW 2 101642311 missense probably damaging 1.00
R5209:Rag1 UTSW 2 101644215 missense probably benign 0.01
R5239:Rag1 UTSW 2 101642955 missense possibly damaging 0.91
R5390:Rag1 UTSW 2 101642734 missense probably benign
R5607:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R6259:Rag1 UTSW 2 101644452 missense possibly damaging 0.83
R6412:Rag1 UTSW 2 101642520 missense probably damaging 0.99
R6633:Rag1 UTSW 2 101642710 missense probably damaging 1.00
R6679:Rag1 UTSW 2 101644284 missense probably damaging 1.00
R6723:Rag1 UTSW 2 101643645 missense probably damaging 0.99
R6853:Rag1 UTSW 2 101642221 missense probably damaging 0.99
R6867:Rag1 UTSW 2 101641947 missense probably damaging 1.00
R6974:Rag1 UTSW 2 101641792 missense probably damaging 0.99
R7071:Rag1 UTSW 2 101643462 missense probably damaging 0.99
R7124:Rag1 UTSW 2 101643783 missense probably damaging 0.99
R7248:Rag1 UTSW 2 101641778 missense probably damaging 0.99
R7256:Rag1 UTSW 2 101642070 missense probably damaging 1.00
R7567:Rag1 UTSW 2 101643661 missense probably damaging 0.98
R7581:Rag1 UTSW 2 101643304 missense possibly damaging 0.95
R7830:Rag1 UTSW 2 101642059 missense probably damaging 1.00
R7941:Rag1 UTSW 2 101642346 missense probably benign 0.24
R8024:Rag1 UTSW 2 101642507 missense probably damaging 1.00
R8434:Rag1 UTSW 2 101642664 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101643597 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101644547 missense probably damaging 0.99
Z1176:Rag1 UTSW 2 101643259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTGCCTGGCATTCATTTTC -3'
(R):5'- TCATGAGGATGAATGGCAACTTTG -3'

Sequencing Primer
(F):5'- TTTCCGAAACCGTCTAAACAGCTTG -3'
(R):5'- AACTTTGCCCGGAAGCTTATGAC -3'
Posted On2015-05-14