Incidental Mutation 'R4127:Pias3'
ID315427
Institutional Source Beutler Lab
Gene Symbol Pias3
Ensembl Gene ENSMUSG00000028101
Gene Nameprotein inhibitor of activated STAT 3
SynonymsPias3L
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96696384-96706070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96699666 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 82 (G82C)
Ref Sequence ENSEMBL: ENSMUSP00000125747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162778] [ENSMUST00000162934] [ENSMUST00000176302]
Predicted Effect probably damaging
Transcript: ENSMUST00000064900
AA Change: G91C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: G91C

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
low complexity region 70 109 N/A INTRINSIC
Pfam:PINIT 126 278 1.1e-38 PFAM
Pfam:zf-MIZ 323 372 1.7e-22 PFAM
low complexity region 608 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107076
AA Change: G82C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: G82C

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.1e-45 PFAM
Pfam:zf-Nse 305 361 8e-7 PFAM
Pfam:zf-MIZ 314 363 2.2e-21 PFAM
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107077
SMART Domains Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
Pfam:PINIT 87 243 5.3e-46 PFAM
Pfam:zf-Nse 279 335 2.4e-7 PFAM
Pfam:zf-MIZ 288 337 7.4e-22 PFAM
low complexity region 573 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161296
Predicted Effect probably benign
Transcript: ENSMUST00000162156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162707
Predicted Effect unknown
Transcript: ENSMUST00000162778
AA Change: G82C
SMART Domains Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101
AA Change: G82C

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162934
AA Change: G82C

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101
AA Change: G82C

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.3e-46 PFAM
Pfam:zf-Nse 305 361 7e-8 PFAM
Pfam:zf-MIZ 314 363 2.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176288
Predicted Effect probably benign
Transcript: ENSMUST00000176302
SMART Domains Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 2.57e-3 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Pias3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Pias3 APN 3 96699422 splice site probably benign
IGL01370:Pias3 APN 3 96703575 missense probably damaging 0.96
IGL01806:Pias3 APN 3 96703757 missense probably benign 0.02
IGL02533:Pias3 APN 3 96699616 missense possibly damaging 0.71
IGL02998:Pias3 APN 3 96702179 missense probably damaging 0.98
IGL03304:Pias3 APN 3 96700031 missense possibly damaging 0.65
R0764:Pias3 UTSW 3 96701295 missense probably damaging 1.00
R1611:Pias3 UTSW 3 96699697 splice site probably null
R1697:Pias3 UTSW 3 96702225 missense probably damaging 1.00
R1751:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R1767:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R2184:Pias3 UTSW 3 96702221 missense possibly damaging 0.92
R2257:Pias3 UTSW 3 96699646 missense probably benign 0.22
R2398:Pias3 UTSW 3 96703813 missense probably benign 0.00
R2851:Pias3 UTSW 3 96703537 missense possibly damaging 0.94
R3845:Pias3 UTSW 3 96702210 missense probably benign 0.28
R4500:Pias3 UTSW 3 96701418 missense probably damaging 1.00
R4628:Pias3 UTSW 3 96699820 missense probably damaging 1.00
R5068:Pias3 UTSW 3 96703855 missense probably damaging 0.98
R5108:Pias3 UTSW 3 96704937 missense possibly damaging 0.88
R5477:Pias3 UTSW 3 96705003 missense probably damaging 0.99
R5498:Pias3 UTSW 3 96702188 missense possibly damaging 0.89
R6457:Pias3 UTSW 3 96699523 missense possibly damaging 0.81
R6966:Pias3 UTSW 3 96702195 missense probably damaging 0.99
R7235:Pias3 UTSW 3 96704363 missense probably benign
R7538:Pias3 UTSW 3 96702218 missense possibly damaging 0.91
R7552:Pias3 UTSW 3 96701385 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTTTCCGAGTGTCTGAGC -3'
(R):5'- AGTCAGCCATACCAAGGGTG -3'

Sequencing Primer
(F):5'- TTCCGAGTGTCTGAGCTCCAG -3'
(R):5'- GGTGGGTCGGATGAGCTCC -3'
Posted On2015-05-14