Incidental Mutation 'R4127:Zranb2'
ID315429
Institutional Source Beutler Lab
Gene Symbol Zranb2
Ensembl Gene ENSMUSG00000028180
Gene Namezinc finger, RAN-binding domain containing 2
SynonymsZis, Zfp265, Znf265
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location157534160-157548410 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 157537590 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 74 (C74*)
Ref Sequence ENSEMBL: ENSMUSP00000101673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029831] [ENSMUST00000106057] [ENSMUST00000106058] [ENSMUST00000184802] [ENSMUST00000198915]
Predicted Effect probably null
Transcript: ENSMUST00000029831
AA Change: C37*
SMART Domains Protein: ENSMUSP00000029831
Gene: ENSMUSG00000028180
AA Change: C37*

DomainStartEndE-ValueType
ZnF_RBZ 11 35 1.02e-2 SMART
ZnF_RBZ 36 54 2.09e-1 SMART
low complexity region 70 82 N/A INTRINSIC
low complexity region 108 145 N/A INTRINSIC
low complexity region 156 293 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106057
AA Change: C74*
SMART Domains Protein: ENSMUSP00000101672
Gene: ENSMUSG00000028180
AA Change: C74*

DomainStartEndE-ValueType
ZnF_RBZ 11 37 1.24e-6 SMART
ZnF_RBZ 77 101 3.11e-7 SMART
low complexity region 117 129 N/A INTRINSIC
low complexity region 155 192 N/A INTRINSIC
low complexity region 203 312 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106058
AA Change: C74*
SMART Domains Protein: ENSMUSP00000101673
Gene: ENSMUSG00000028180
AA Change: C74*

DomainStartEndE-ValueType
ZnF_RBZ 11 37 1.24e-6 SMART
ZnF_RBZ 77 101 3.11e-7 SMART
low complexity region 117 129 N/A INTRINSIC
low complexity region 155 192 N/A INTRINSIC
low complexity region 203 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106063
SMART Domains Protein: ENSMUSP00000101678
Gene: ENSMUSG00000028180

DomainStartEndE-ValueType
ZnF_RBZ 11 37 8.79e-7 SMART
ZnF_RBZ 67 91 3.11e-7 SMART
low complexity region 107 119 N/A INTRINSIC
low complexity region 145 182 N/A INTRINSIC
low complexity region 193 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152882
Predicted Effect probably benign
Transcript: ENSMUST00000184802
AA Change: A38E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196900
Predicted Effect probably benign
Transcript: ENSMUST00000198915
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Other mutations in Zranb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Zranb2 APN 3 157546691 unclassified probably benign
IGL01528:Zranb2 APN 3 157544965 unclassified probably benign
IGL03008:Zranb2 APN 3 157546665 splice site probably null
R0528:Zranb2 UTSW 3 157534459 missense probably benign 0.26
R0659:Zranb2 UTSW 3 157541763 missense probably benign 0.23
R1170:Zranb2 UTSW 3 157541865 utr 3 prime probably benign
R1673:Zranb2 UTSW 3 157537640 missense probably damaging 1.00
R1885:Zranb2 UTSW 3 157543156 critical splice acceptor site probably null
R4610:Zranb2 UTSW 3 157541884 splice site probably benign
R4981:Zranb2 UTSW 3 157546741 unclassified probably benign
R5053:Zranb2 UTSW 3 157541159 missense probably damaging 0.96
R5742:Zranb2 UTSW 3 157540703 nonsense probably null
R5873:Zranb2 UTSW 3 157536383 nonsense probably null
R6086:Zranb2 UTSW 3 157543246 critical splice donor site probably null
R7015:Zranb2 UTSW 3 157536733 critical splice acceptor site probably null
R7547:Zranb2 UTSW 3 157541169 missense possibly damaging 0.93
R7579:Zranb2 UTSW 3 157540672 missense probably damaging 1.00
R8119:Zranb2 UTSW 3 157536332 critical splice acceptor site probably null
R8237:Zranb2 UTSW 3 157545040 missense probably null
R8296:Zranb2 UTSW 3 157541775 missense unknown
R8345:Zranb2 UTSW 3 157546094 missense unknown
R8414:Zranb2 UTSW 3 157546675 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCCCTCAGTAGCAGAATTTCTAG -3'
(R):5'- GCTAGTGTAAGGCTGCCTAG -3'

Sequencing Primer
(F):5'- CCTCAGTAGCAGAATTTCTAGTTATG -3'
(R):5'- ATATCGAGTTTGAGGCCATCCAG -3'
Posted On2015-05-14