Incidental Mutation 'R4127:Scp2'
ID315431
Institutional Source Beutler Lab
Gene Symbol Scp2
Ensembl Gene ENSMUSG00000028603
Gene Namesterol carrier protein 2, liver
SynonymsNSL-TP, nonspecific lipid transfer protein, SCPx, SCP-2, ns-LTP
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108043839-108144998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108063984 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000102312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000044248] [ENSMUST00000106701]
Predicted Effect probably benign
Transcript: ENSMUST00000030340
AA Change: F414L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603
AA Change: F414L

DomainStartEndE-ValueType
Pfam:Thiolase_N 14 240 9.6e-25 PFAM
Pfam:Thiolase_C 277 402 2.9e-15 PFAM
Pfam:SCP2 437 539 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106701
AA Change: F10L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102312
Gene: ENSMUSG00000028603
AA Change: F10L

DomainStartEndE-ValueType
Pfam:Alkyl_sulf_C 18 140 5e-11 PFAM
Pfam:SCP2 33 135 4.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135379
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Scp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Scp2 APN 4 108074442 splice site probably null
IGL02190:Scp2 APN 4 108087128 missense probably benign 0.22
IGL02615:Scp2 APN 4 108107631 missense probably benign 0.40
IGL03006:Scp2 APN 4 108091280 missense probably benign 0.00
IGL03107:Scp2 APN 4 108098115 missense probably benign 0.00
IGL03124:Scp2 APN 4 108063906 missense probably damaging 1.00
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R1507:Scp2 UTSW 4 108087012 frame shift probably null
R1861:Scp2 UTSW 4 108091321 missense probably damaging 1.00
R2151:Scp2 UTSW 4 108063944 missense probably benign
R3013:Scp2 UTSW 4 108071357 missense probably damaging 1.00
R4271:Scp2 UTSW 4 108085211 missense probably damaging 1.00
R4385:Scp2 UTSW 4 108071350 missense probably damaging 1.00
R5046:Scp2 UTSW 4 108071291 missense probably benign 0.07
R5345:Scp2 UTSW 4 108055579 splice site probably null
R5401:Scp2 UTSW 4 108144779 critical splice donor site probably null
R6367:Scp2 UTSW 4 108112250 missense probably damaging 1.00
R6415:Scp2 UTSW 4 108105140 missense probably benign 0.22
R6681:Scp2 UTSW 4 108091316 missense probably damaging 1.00
R6910:Scp2 UTSW 4 108105086 missense probably damaging 1.00
R6974:Scp2 UTSW 4 108071278 start codon destroyed probably null 0.01
R7206:Scp2 UTSW 4 108074441 missense probably benign 0.00
R7342:Scp2 UTSW 4 108091321 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTAGTGCACCTTGAGCATTAG -3'
(R):5'- ATACGTTTCAGGAGGGTGGC -3'

Sequencing Primer
(F):5'- ACCTTGAGCATTAGGTGAGATCTCC -3'
(R):5'- GGCTTCACCTAGTGAGAACTTAG -3'
Posted On2015-05-14