Incidental Mutation 'R4127:Pxn'
ID315433
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Namepaxillin
SynonymsPax
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115506676-115555987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115546907 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 264 (R264G)
Ref Sequence ENSEMBL: ENSMUSP00000148843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000137716] [ENSMUST00000157050] [ENSMUST00000202564] [ENSMUST00000212819]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067268
AA Change: R264G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528
AA Change: R264G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086523
AA Change: R264G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528
AA Change: R264G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134198
Predicted Effect probably benign
Transcript: ENSMUST00000137716
SMART Domains Protein: ENSMUSP00000144513
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 1.9e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153682
Predicted Effect probably benign
Transcript: ENSMUST00000157050
SMART Domains Protein: ENSMUSP00000143926
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 106 1.4e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202564
AA Change: R131G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528
AA Change: R131G

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212819
AA Change: R264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115544926 missense probably benign 0.00
IGL02432:Pxn APN 5 115545746 missense probably damaging 1.00
IGL02454:Pxn APN 5 115552266 missense probably damaging 1.00
R0316:Pxn UTSW 5 115553968 missense probably damaging 1.00
R0778:Pxn UTSW 5 115552177 missense probably damaging 1.00
R1680:Pxn UTSW 5 115552147 missense probably damaging 1.00
R1874:Pxn UTSW 5 115544990 missense probably damaging 1.00
R2069:Pxn UTSW 5 115545667 missense probably benign 0.26
R2145:Pxn UTSW 5 115552756 unclassified probably benign
R4124:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4126:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4551:Pxn UTSW 5 115552720 unclassified probably benign
R4717:Pxn UTSW 5 115551942 missense probably damaging 0.99
R5217:Pxn UTSW 5 115544915 missense probably benign 0.13
R5332:Pxn UTSW 5 115544369 missense probably damaging 1.00
R5635:Pxn UTSW 5 115551492 missense probably benign
R5681:Pxn UTSW 5 115544534 missense possibly damaging 0.94
R6629:Pxn UTSW 5 115554062 missense probably damaging 1.00
R6702:Pxn UTSW 5 115551896 missense probably benign 0.11
R7516:Pxn UTSW 5 115506863 missense unknown
R7671:Pxn UTSW 5 115548547 missense not run
R7749:Pxn UTSW 5 115548516 missense probably benign 0.00
R7866:Pxn UTSW 5 115548606 missense possibly damaging 0.85
R8196:Pxn UTSW 5 115545709 missense probably damaging 0.99
R8244:Pxn UTSW 5 115552243 missense probably damaging 1.00
X0018:Pxn UTSW 5 115545732 missense probably damaging 1.00
X0025:Pxn UTSW 5 115546895 missense probably damaging 0.97
X0065:Pxn UTSW 5 115551487 critical splice acceptor site probably null
Z1177:Pxn UTSW 5 115553893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGGTACTGGAGACCTGATC -3'
(R):5'- CCAGCTAAAAGAGGCTCTGG -3'

Sequencing Primer
(F):5'- TACTGGAGACCTGATCCCCTGTG -3'
(R):5'- CAGCTAAAAGAGGCTCTGGTTTCTC -3'
Posted On2015-05-14