Incidental Mutation 'R4127:Tmem132d'
ID315434
Institutional Source Beutler Lab
Gene Symbol Tmem132d
Ensembl Gene ENSMUSG00000034310
Gene Nametransmembrane protein 132D
Synonyms
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location127781630-128433077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128268820 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 213 (R213G)
Ref Sequence ENSEMBL: ENSMUSP00000043633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044441]
Predicted Effect probably benign
Transcript: ENSMUST00000044441
AA Change: R213G

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043633
Gene: ENSMUSG00000034310
AA Change: R213G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM132D_N 49 178 1.9e-59 PFAM
Pfam:TMEM132 435 778 3.9e-150 PFAM
Pfam:TMEM132D_C 884 970 1.9e-37 PFAM
low complexity region 998 1011 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200316
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Tmem132d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmem132d APN 5 127784832 missense possibly damaging 0.77
IGL01393:Tmem132d APN 5 127784638 missense probably benign 0.31
IGL01482:Tmem132d APN 5 128269206 missense probably damaging 0.96
IGL01785:Tmem132d APN 5 127984315 missense probably benign 0.00
IGL02409:Tmem132d APN 5 127784888 missense probably damaging 1.00
IGL02539:Tmem132d APN 5 127783979 missense probably benign 0.01
IGL03411:Tmem132d APN 5 127984283 nonsense probably null
R0113:Tmem132d UTSW 5 127784593 missense probably benign 0.11
R0420:Tmem132d UTSW 5 127864646 missense probably benign 0.26
R0437:Tmem132d UTSW 5 127789785 missense probably damaging 0.99
R0468:Tmem132d UTSW 5 128269203 missense probably damaging 1.00
R0564:Tmem132d UTSW 5 127784778 missense probably damaging 1.00
R0659:Tmem132d UTSW 5 127984287 missense possibly damaging 0.94
R0924:Tmem132d UTSW 5 127984439 splice site probably benign
R1209:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R1333:Tmem132d UTSW 5 127784859 missense probably benign
R1378:Tmem132d UTSW 5 128268947 missense probably benign 0.43
R1741:Tmem132d UTSW 5 127784858 missense probably benign 0.30
R1753:Tmem132d UTSW 5 127789855 missense probably benign 0.02
R1944:Tmem132d UTSW 5 127783764 makesense probably null
R1974:Tmem132d UTSW 5 128269199 missense probably damaging 0.99
R2035:Tmem132d UTSW 5 127792458 missense probably damaging 1.00
R2065:Tmem132d UTSW 5 127784441 missense probably benign
R2074:Tmem132d UTSW 5 128269131 missense probably damaging 1.00
R2276:Tmem132d UTSW 5 127795923 missense probably damaging 1.00
R2297:Tmem132d UTSW 5 128268544 missense possibly damaging 0.69
R2424:Tmem132d UTSW 5 127864599 missense probably benign 0.09
R2902:Tmem132d UTSW 5 127783768 missense probably benign
R3053:Tmem132d UTSW 5 127792474 missense probably benign 0.15
R3836:Tmem132d UTSW 5 127784885 missense probably damaging 1.00
R4236:Tmem132d UTSW 5 128432325 missense possibly damaging 0.89
R4358:Tmem132d UTSW 5 127984341 missense possibly damaging 0.92
R4610:Tmem132d UTSW 5 127984296 missense probably benign 0.29
R4686:Tmem132d UTSW 5 127792610 missense possibly damaging 0.55
R4814:Tmem132d UTSW 5 127984264 missense probably benign 0.01
R4883:Tmem132d UTSW 5 128269300 missense probably damaging 0.99
R4883:Tmem132d UTSW 5 128269302 missense possibly damaging 0.79
R4939:Tmem132d UTSW 5 127796075 missense probably damaging 1.00
R5579:Tmem132d UTSW 5 127796000 missense possibly damaging 0.67
R5652:Tmem132d UTSW 5 127784795 missense possibly damaging 0.88
R5801:Tmem132d UTSW 5 127784900 missense possibly damaging 0.50
R5900:Tmem132d UTSW 5 128269272 missense probably damaging 1.00
R5980:Tmem132d UTSW 5 127784598 missense probably benign 0.13
R6048:Tmem132d UTSW 5 128269117 missense probably benign 0.03
R6057:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R6084:Tmem132d UTSW 5 127784100 missense probably benign 0.06
R6505:Tmem132d UTSW 5 127784438 missense probably benign 0.00
R6522:Tmem132d UTSW 5 127783768 missense probably benign
R6540:Tmem132d UTSW 5 128268532 missense possibly damaging 0.87
R6717:Tmem132d UTSW 5 127784421 missense probably benign
R7158:Tmem132d UTSW 5 128137019 missense possibly damaging 0.81
R7287:Tmem132d UTSW 5 127984351 missense probably damaging 0.96
R7526:Tmem132d UTSW 5 127784141 nonsense probably null
R7826:Tmem132d UTSW 5 127789889 missense probably damaging 1.00
R7864:Tmem132d UTSW 5 127783916 missense probably damaging 1.00
R8124:Tmem132d UTSW 5 127792560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTCCCAATTCTATGCAAAGG -3'
(R):5'- GGAGAAAGTCTACCTGAGCCATC -3'

Sequencing Primer
(F):5'- GGGGACTGGATTCATCAACATCATTG -3'
(R):5'- ATCCCAAAGTGCAGGTGCTC -3'
Posted On2015-05-14