Incidental Mutation 'R4127:Chn2'
ID315435
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Namechimerin 2
Synonyms4930557O16Rik, 1700026N20Rik
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location54039554-54301810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54272978 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 24 (R24M)
Ref Sequence ENSEMBL: ENSMUSP00000145507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000203091] [ENSMUST00000203941] [ENSMUST00000204115] [ENSMUST00000204746] [ENSMUST00000204921]
Predicted Effect probably benign
Transcript: ENSMUST00000046856
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067741
AA Change: R24M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633
AA Change: R24M

DomainStartEndE-ValueType
C1 79 128 1.88e-15 SMART
RhoGAP 152 329 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114401
SMART Domains Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 274 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114402
SMART Domains Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 224 2.07e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145111
Predicted Effect probably benign
Transcript: ENSMUST00000146114
SMART Domains Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 29 78 1.88e-15 SMART
RhoGAP 102 279 2.73e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203091
AA Change: R24M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633
AA Change: R24M

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
Pfam:RhoGAP 155 196 5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203941
AA Change: R24M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633
AA Change: R24M

DomainStartEndE-ValueType
RhoGAP 101 225 1.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204115
AA Change: R24M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633
AA Change: R24M

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 101 257 3.7e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204746
AA Change: R24M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633
AA Change: R24M

DomainStartEndE-ValueType
RhoGAP 101 271 4.7e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204921
AA Change: R24M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633
AA Change: R24M

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 152 283 4.9e-37 SMART
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54295922 critical splice donor site probably null
IGL02158:Chn2 APN 6 54300245 unclassified probably benign
IGL02618:Chn2 APN 6 54220437 missense probably damaging 1.00
IGL02807:Chn2 APN 6 54295913 missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54194077 missense probably benign 0.02
R0002:Chn2 UTSW 6 54273113 missense probably benign 0.08
R0123:Chn2 UTSW 6 54290451 splice site probably benign
R0225:Chn2 UTSW 6 54290451 splice site probably benign
R1478:Chn2 UTSW 6 54293080 missense probably damaging 1.00
R1905:Chn2 UTSW 6 54286121 missense probably damaging 1.00
R3769:Chn2 UTSW 6 54290411 missense probably damaging 1.00
R3946:Chn2 UTSW 6 54269426 unclassified probably benign
R4125:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4128:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4614:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R4616:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R5063:Chn2 UTSW 6 54290287 nonsense probably null
R5121:Chn2 UTSW 6 54218561 missense possibly damaging 0.57
R5208:Chn2 UTSW 6 54295801 missense probably damaging 0.97
R5240:Chn2 UTSW 6 54220695 missense probably benign
R5348:Chn2 UTSW 6 54300218 missense probably damaging 0.99
R5861:Chn2 UTSW 6 54290374 missense probably damaging 1.00
R6539:Chn2 UTSW 6 54173461 splice site probably null
R6824:Chn2 UTSW 6 54272953 missense probably benign 0.00
R7194:Chn2 UTSW 6 54286177 splice site probably null
R7740:Chn2 UTSW 6 54300171 missense probably benign 0.18
R7765:Chn2 UTSW 6 54298152 critical splice donor site probably null
R7997:Chn2 UTSW 6 54290285 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCTTCCAGGTCACATG -3'
(R):5'- GACTCTTACCTTGAAGTTGTGTGTC -3'

Sequencing Primer
(F):5'- AGAACACAGCTGCCTCAAGTCTG -3'
(R):5'- ACCTTGAAGTTGTGTGTCTTCTC -3'
Posted On2015-05-14