Incidental Mutation 'R4127:Actg2'
ID315436
Institutional Source Beutler Lab
Gene Symbol Actg2
Ensembl Gene ENSMUSG00000059430
Gene Nameactin, gamma 2, smooth muscle, enteric
SynonymsAct4, Act-4, ACTA3, SMGA
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83512905-83536265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83522884 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 128 (F128Y)
Ref Sequence ENSEMBL: ENSMUSP00000121577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075161] [ENSMUST00000121731] [ENSMUST00000141904] [ENSMUST00000152029] [ENSMUST00000205926]
Predicted Effect probably benign
Transcript: ENSMUST00000075161
AA Change: F128Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074658
Gene: ENSMUSG00000059430
AA Change: F128Y

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121731
AA Change: F128Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113552
Gene: ENSMUSG00000059430
AA Change: F128Y

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124933
Predicted Effect probably benign
Transcript: ENSMUST00000141904
AA Change: F128Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120936
Gene: ENSMUSG00000059430
AA Change: F128Y

DomainStartEndE-ValueType
ACTIN 6 270 4.78e-116 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152029
AA Change: F128Y

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121577
Gene: ENSMUSG00000059430
AA Change: F128Y

DomainStartEndE-ValueType
ACTIN 6 195 1.09e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205926
AA Change: F55Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Actg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Actg2 APN 6 83523175 missense probably damaging 1.00
PIT4508001:Actg2 UTSW 6 83513007 missense possibly damaging 0.92
R0309:Actg2 UTSW 6 83519914 missense probably damaging 1.00
R0319:Actg2 UTSW 6 83520743 missense probably damaging 1.00
R1253:Actg2 UTSW 6 83522887 missense probably damaging 1.00
R1619:Actg2 UTSW 6 83523187 missense probably damaging 1.00
R1677:Actg2 UTSW 6 83522819 missense possibly damaging 0.92
R2512:Actg2 UTSW 6 83526847 missense probably damaging 1.00
R4195:Actg2 UTSW 6 83523173 missense probably damaging 1.00
R5165:Actg2 UTSW 6 83526832 missense probably benign 0.22
R5661:Actg2 UTSW 6 83520772 missense probably damaging 0.98
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6707:Actg2 UTSW 6 83513094 nonsense probably null
R7069:Actg2 UTSW 6 83520763 missense probably damaging 1.00
R7763:Actg2 UTSW 6 83527368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTCTGCCTTTCAAAACAGAAGG -3'
(R):5'- AGCACTGTGTAGCAATGCAG -3'

Sequencing Primer
(F):5'- CTGCCTTTCAAAACAGAAGGTATGGC -3'
(R):5'- GCAGTAAAATGTCCTTACAGATCTGC -3'
Posted On2015-05-14