Incidental Mutation 'R4127:Gm5592'
ID315437
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41289067 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 591 (G591D)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
Predicted Effect probably benign
Transcript: ENSMUST00000097044
AA Change: G591D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: G591D

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
AA Change: G591D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGGCCACAGAACAAATCC -3'
(R):5'- CAGCTCATACTGGGATGGAG -3'

Sequencing Primer
(F):5'- GCTTAAGCAGTCAAGGAACAC -3'
(R):5'- CTGGGATGGAGATAGACAATCTTTG -3'
Posted On2015-05-14