Incidental Mutation 'R4127:Polg'
ID315438
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79455537 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 753 (E753G)
Ref Sequence ENSEMBL: ENSMUSP00000073551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000139290] [ENSMUST00000149444] [ENSMUST00000201907]
Predicted Effect probably damaging
Transcript: ENSMUST00000073889
AA Change: E753G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: E753G

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127734
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139597
Predicted Effect unknown
Transcript: ENSMUST00000139668
AA Change: E219G
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176
AA Change: E219G

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142915
Predicted Effect probably benign
Transcript: ENSMUST00000143672
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145154
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154403
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect probably benign
Transcript: ENSMUST00000201907
SMART Domains Protein: ENSMUSP00000144084
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
Blast:POLAc 1 49 4e-24 BLAST
PDB:3IKM|D 1 50 6e-24 PDB
SCOP:d1t7pa2 21 49 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201030
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Olfr1163 A G 2: 88,071,235 V49A probably benign Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
R7879:Polg UTSW 7 79450644 missense probably benign 0.22
R8174:Polg UTSW 7 79456718 missense probably benign 0.10
R8443:Polg UTSW 7 79464995 missense probably benign
Z1176:Polg UTSW 7 79453741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGGCAAGTCACCAATG -3'
(R):5'- GCACTTAAAGATATGCAGGATACC -3'

Sequencing Primer
(F):5'- GGCAAGTCACCAATGCCAGAG -3'
(R):5'- ATACCTGGTGGGAACTGCC -3'
Posted On2015-05-14